Pt3ts ncas9n

The target genes were il-34 (NCBI accession: NM_001128701.1; Gene ID: 560193) and csf3r (NCBI accession: NM_001113377.1; Gene ID: 100134935). Co-injection of Cas9 mRNA and guide RNAs (gRNAs) was conducted in wild-type 1-cell stage zebrafish embryos. Cas9 mRNA was transcribed from XbaI linearalized pT3TS-nCas9n plasmid (Addgene #46757) using mMessage mMachine T3 Kit (Ambion) according to the manufacturer’s instructions. CRISPR targets for gRNA designs were identified using CHOPCHOP (http://chopchop.cbu.uib.no) (Gagnon et al., 2014 (link)). Gene-specific oligonucleotides using T7 promoter were used to make gRNAs as previously described (Gagnon et al., 2014 (link)). gRNA target sequences and genotyping primers are provided in Supplementary file 1. In vitro transcription of gRNAs from assembled oligonucleotides was conducted using the HiScribe T7 Quick High Yield RNA Synthesis Kit (NEB). To ensure high mutagenesis rate and large deletion mutations, three gRNAs were simultaneously injected with Cas9 mRNA for each gene. Injected clutches of embryos were validated to contain CRISPR mediated mutagenesis by a T7 endonuclease assay. Mutations were analyzed by TOPO TA cloning followed by Sanger sequencing.

The nkx6.1 and ascl1b mutant lines were generated by CRISPR/Cas9 technology essentially as described previously [31 (link), 66 (link)]. The targeted sites were selected using the ZiFiT software package [67 ] in the first exon of nkx6.1 (CCAAACCCCTGACAGAGCTTC) before the homeodomain coding region and in the first exon of ascl1b (GGAGACGCTGCGCTCCGCCGTGG) corresponding to the helix-loop-helix coding domain. The selected oligonucleotides were inserted into the plasmid DR274 (Addgene) and the gRNA (guide RNA) was synthesized by in vitro transcription using T7 RNA polymerase. Fertilized zebrafish eggs were injected with about 1 nl of a solution containing 50 ng of gRNA and 300 ng of nls-zCas9-nls mRNA obtained by transcription of the plasmid pT3TS-nCas9n (Addgene). The efficiency of mutagenesis was verified by genotyping using Heteroduplex Migration Assays [68 (link)] after amplification of targeted genomic sequences. Injected embryos were raised until adulthood and crossed with wild-type fish to generate heterozygote mutant F1 fish. Fish harboring frame-shift mutations were kept and used to raise F2 mutant lines, i.e. the ascl1b^ulg-M2C and nkx6.1^ulg-M5 lines carrying, respectively, 11 and seven nucleotide deletions.

Gene Knockouts were generated as described previously [72 (link)]. gRNA target sites were identified using the Zhang lab gRNA design tool (gRNA sequencing and target sites listed in S3 Fig). The CRISPR gRNA sequences were cloned into pDR274 (Addgene NO. 42250). The Cas9 mRNA was transcribed from pT3TS-nCas9n (Addgene No. 46757) [73 (link)]. After cloning specific target plasmids/guides into pCS2 variant vector, mRNA was generated by in vitro transcription of NotI-HF linearized DNA using the Invitrogen mMESSAGE mMACHINE SP6 Transcription Kit (Fisher Scientific AM1340) and purified with the MEGAclear Transcription Clean Up Kit (Fisher Scientific AM1908). 1-2nl of sgRNA/Cas9 mRNA was microinjected into the yolk of one-cell-stage wild-type zebrafish embryos. For indel efficiency evaluation, genomic DNA was extracted from ~24 3dpf injected embryos and evaluated with HRM (see below). The remaining embryos (F0s) from the same clutches were raised. Out-of-frame indels identified in F1 progeny with Sanger sequencing were maintained and propagated. To “clean up” genetic background all lines were bred at least 2 generations to the wild-type strain AB.

The identification and design of target sites to specifically knock out the cfdp1 gene was performed by using the online CRISPR design tool CHOPCHOP v2 (https://chopchop.cbu.uib.no/ accessed 1 October 2019). The selected target site is located in exon 3 and the sequence is 5′-CAGTAGGAGACATTGAAGAGCGG-3′ (where the downstream underscored 3nt CGG represents the PAM sequence, which is immediately adjacent to the target site without being part of it). CRISPR gRNA mutagenesis was designed according to [35 (link)] and, briefly, the protocol used is as follows: the oligos were synthesized, annealed and cloned in pT7-gRNA (Addgene, Watertown, NY, USA, plasmid #46759). For making nls-zCas9-nls mRNA, the DNA vector pT3TS-nCas9n (Addgene, Watertown, USA, plasmid #46757) was linearized by XbaI digestion and purified.

Vectors pT3TS-nCas9n (46757) and pT7-gRNA (46759) were obtained from Addgene. A pair of oligos for each targeting site (Supplementary Table 1) was annealed and ligated to linearized pT7-gRNA vector. Linearized pT3TS-nCas9n was purified and used as the template for in vitro transcription (IVT) using mMESSAGE mMACHINE T3 Transcription Kit (AM1348; ThermoFisher Scientific). The ligated sgRNA constructs were linearized, purified and then used as the template for IVT using MEGAshortscript T7 Transcription Kit (AM1354; ThermoFisher Scientific). Both the Cas9 mRNA and the sgRNAs were purified using MEGAclear kit (AM1908; ThermoFisher Scientific) and eluted in RNase-free water.
C57BL/6J females at 9–15 weeks of age were screened for non-estrus state and were superovulated with 5-5.5 IU PMSG (Millipore). 46.5 h later mice were given 5-5.5 IU HCG (Sigma) and mated 1.5 h later to C57BL/6J males. The next morning the females were checked for the presence of a vaginal plug, and those having one were harvested for fertilized eggs. Injection of the CRISPR reagents into the pronucleus was performed by using an Eppendorf FemptoJet. Surviving eggs were transplanted in CD-1 pseudopregnant females. The founders were screened with PCR followed by sequencing. The sgRNAs and corresponding deletions obtained are listed in Supplementary Table 1.