Pcmv6 an ddk

Manufactured by OriGene

Sourced in United States

PCMV6-AN-DDK is a plasmid vector designed for the expression of proteins in mammalian cells. The vector contains the CMV promoter for high-level expression and an N-terminal DDK tag for detection and purification of the expressed protein.

Automatically generated - may contain errors

Lab products found in correlation

Pcmv6 an ha, by OriGene (2 mentions) Ps100014, by OriGene (1 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions) In fusion hd cloning kit, by Takara Bio (1 mentions) Mycoalert mycoplasma detection kit, by Lonza (1 mentions)

Spelling variants of this product

PCMV6-AN-Myc-DDK (7 citations) PCMV6-AN-Myc-DDK tagged vector (2 citations)

6 protocols using pcmv6 an ddk

Mammalian Expression Constructs for DNA Polymerases

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

The wild-type FLAG-Pol ι (pJRM46) and wild-type HA-Pol η (pJRM56) expression vectors has been described previously,^{32 (link)} as have the FLAG-Pol ι 1–590 and 1–420C-terminal truncations constructs.^{34 (link)} The wild-type HA-Pol ι expression plasmid was created by subcloning the Pol ι coding sequence from the wild-type FLAG-Pol ι vector into the AsiSI and MluI restriction sites of pCMV6-AN-HA (Origene). The coding sequences of Pol κ and Rev1 were synthesized and cloned into the AsiSI and HindIII restriction sites of pCMV6-AN-HA. Pol ι 1–420, Pol η 1–449 and Pol κ 1–542c-terminal truncation constructs were created by introducing STOP codons into the WT plasmids by site-directed mutagenesis. The coding sequence for the Rev1 catalytic domain (aa 321–843) was synthesized and cloned into pCMV6-AN-HA.
The coding sequences for RAD23A and RAD23B were synthesized and cloned into the AsiSI and HindIII restriction sites of pCMV6-AN-DDK (Origene) and pCMV6-AN-HA to create the N-terminal FLAG- and HA-RAD23A and RAD23B mammalian expression constructs, respectively. Truncation and point mutant constructs of the RAD23 proteins were constructed by synthesizing new gene fragments and subcloning into the wild-type plasmids using restriction sites flanking or contained within the coding sequences.

Ashton N.W., Jaiswal N., Moreno N.C., Semenova I.V., D’Orlando D.A., Latancia M.T., McIntyre J., Woodgate R, & Bezsonova I. (2023). A Novel Interaction Between RAD23A/B and Y-family DNA Polymerases. Journal of molecular biology, 435(24), 168353.

+ Open protocol

+ Expand

TACI and BCMA Expression Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human TACI in pCMV6-XL4, human BCMA in pCMV6-XL5 and the control vector pCMV6-AN-DDK were purchased from Origene Technologies. A C-terminal FLAG-tag, an N-terminal FLAG-tag and an N-terminal HA-tag were added to TACI in pcDNA3.1 using standard cloning procedures. To generate TACI-Δ-Ecto, the TACI sequence coding for amino acids 155–293 was cloned into pcDNA3.1. CRE followed by the T2A peptide sequence and GFP or GFP alone were cloned into the retroviral vector pMSCV. The pCL-Eco packaging construct was additionally used for retrovirus production.

Hoffmann F.S., Kuhn P.H., Laurent S.A., Hauck S.M., Berer K., Wendlinger S.A., Krumbholz M., Khademi M., Olsson T., Dreyling M., Pfister H.W., Alexander T., Hiepe F., Kümpfel T., Crawford H.C., Wekerle H., Hohlfeld R., Lichtenthaler S.F, & Meinl E. (2014). The immunoregulator soluble TACI is released by ADAM10 and reflects B-cell activation in autoimmunity. Journal of immunology (Baltimore, Md. : 1950), 194(2), 542-552.

+ Open protocol

+ Expand

Cloning and Sequencing of Human LSS Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols

Wild-type, R234fs, and R177Q human LSS cDNAs (NM_002340.5, carrying SNP rs2254422 and rs2254524) were prepared by RT-PCR with RNA from the blood of the patients and their family members. cDNAs were subcloned into pCMV6-AN-DDK (PS100014, OriGene, Rockville, MD, USA). The final constructs were verified by sequencing.

Wada Y., Kikuchi A., Kaga A., Shimizu N., Ito J., Onuma R., Fujishima F., Totsune E., Sato R., Niihori T., Shirota M., Funayama R., Sato K., Nakazawa T., Nakayama K., Aoki Y., Aiba S., Nakagawa K, & Kure S. (2020). Metabolic and pathologic profiles of human LSS deficiency recapitulated in mice. PLoS Genetics, 16(2), e1008628.

+ Open protocol

+ Expand

Construction of Polι Expression Plasmids

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Plasmid pJRM46 is a derivative of pCMV6AN-DDK (Origene Technologies, Rockville, MD), which expresses N-terminal FLAG-tagged full-length human polι (13 (link)). Derivatives with single or multiple Lys → Ala or Lys → Arg substitutions were generated by chemically synthesizing appropriate DNA fragments (Genscript) that were subsequently cloned into pJRM46. Plasmid pRK7-POLI-3XFLAG is a derivative of pRK7 (38 (link)), which expresses full-length human polι with three C-terminal FLAG tags. The vector was constructed by inserting three tandem repeats of the FLAG epitope tag (DYKDDDDK) into the BamHI and EcoRI sites of pRK7 to generate pRK7–3XFLAG. The full-length human POLI gene was amplified from HEK293T cells by reverse transcription-PCR using primers POLI-S (AAAGCTAGCATGGAGAAGCTGGGGGTGGA) and POLI-AS (AAAGGATCCTTTATGTCCAATGTGGAAATCT). These primers introduce 5′ NheI and 3′ BamHI sites into the amplicon, which was subcloned into the XbaI and BamHI sites of the pRK7–3XFLAG vector. A full list of plasmids used in the current study is shown in Table 1.

McIntyre J., McLenigan M.P., Frank E.G., Dai X., Yang W., Wang Y, & Woodgate R. (2015). Posttranslational Regulation of Human DNA Polymerase ι. The Journal of Biological Chemistry, 290(45), 27332-27344.

+ Open protocol

+ Expand

Soft-Templated Mesoporous Silica Nanoparticles and GPI-Anchored Immunotherapies

Check if the same lab product or an alternative is used in the 5 most similar protocols

The MSNs were synthesized using a soft-templating method [28] . A mixture of 1.90 g of cetyltrimethylammonium tosylate (CTATos, MERK) and 0.35 g of triethanolamine (TEAH 3 ) in 0.1 L of deionized water was stirred at 80°C for 1 h and 14.58 g of tetraethyl-orthosilicate (TEOS) was quickly added into the surfactant solution. The mixture was stirred at 80°C with a stirring speed of 1200 rpm for another 2 h. The synthesized C-MSNs were ltered, washed, and dried in the oven at 100°C for 20 h. 2.4. Construction of GPI-anchored CD80 and anti-Her2 scFv GPI-CD80 cDNA was constructed by fusing cDNA encoding the extracellular domain of CD80 and the GPIanchor signal sequence of LFA-3 [29; 30] . The chimeric CD80-LFA3 cDNA was ligated into pCMV6-AN-HA (PS100013, Origene, USA), a mammalian expression vector with N-terminal HA tag. For construction of GPI-anchored anti-Her2 scFv, the amino acid sequence of anti-Her2 scFv was further constructed by the protein sequence published by Carter et al. and which express the single-chain antibody with neutralizing Her2 activity [31; 32] . The chimeric anti-Her2 scFv-LFA3 cDNA was cloned into pCMV6-AN-DDK (PS100014, Origene, USA) a mammalian expression vector with N-terminal DDK tag. Constructed plasmid was transfected into CHO cells with lipofectamine™ 2000 (11668027, Invitrogen, USA).

Tang S., Zhu H., Yi X., Fu Q., Fu Y., Liu Y., Huang Z., Zhu K., Hou H., Sun C., Zhong C., Liu W., Li Z., Wang B., & Wo J. (2022). Novel biomimetic mesoporous silica nanoparticles system possessed targetability and immune synergy to promote solid tumor immuno- chemotherapy efficacy.

+ Open protocol

+ Expand

GALM cDNA Expression and Cell Line Generation

Check if the same lab product or an alternative is used in the 5 most similar protocols

The GALM complementary DNA (cDNA) (IRAK015M11) was provided by the RIKEN Bioresource Center (BRC) through the National Bio-Resource Project of the Ministry of Education, Culture, Sports, Science and Technology (MEXT), Japan, [22] [23] [24] [25] and was subcloned into pCMV6-AN-DDK (PS100014, OriGene, Rockville, MD, USA) or pET21d(+) (69743, Novagen, Merck Millipore, Darmstadt, Germany) with a His6 tag at the N-terminus using the In-Fusion HD Cloning Kit (TaKaRa, Shiga, Japan). Then, 293FT cells (R700-07, Invitrogen™) were cultured in Dulbecco's modified Eagle's medium (DMEM) containing high glucose supplemented with 10% fetal bovine serum, and 1% penicillin and streptomycin (100 U/ml and 100 μg/ml, respectively) at 37 °C in a 5% CO 2 incubator. Epstein-Barr virus transformed lymphoblastoid cell lines (EBV-LCLs) were established from patients 2, 3, 8, and healthy controls using previously described methods. 26 All cell lines were tested for mycoplasma contamination using a MycoAlert™ Mycoplasma Detection Kit (LT07-118, Lonza, Basel, Switzerland).

Wada Y., Kikuchi A., Arai-Ichinoi N., Sakamoto O., Takezawa Y., Iwasawa S., Niihori T., Nyuzuki H., Nakajima Y., Ogawa E., Ishige M., Hirai H., Sasai H., Fujiki R., Shirota M., Funayama R., Yamamoto M., Ito T., Ohara O., Nakayama K., Aoki Y., Koshiba S., Fukao T, & Kure S. (2019). Biallelic GALM pathogenic variants cause a novel type of galactosemia. Genetics in medicine : official journal of the American College of Medical Genetics, 21(6).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!