Jumpstart accutaq la dna polymerase

For Renilla reporter experiments, a 551-bp fragment of the SCD5 3′ UTR containing the predicted miR-221 and miR-222 binding sites was amplified by PCR from normal human genomic DNA using a JumpStart™ AccuTaq™ LA DNA Polymerase (Sigma-Aldrich,). The putative SCD5 seed starts at nt 2780 of the SCD5 sequence (NCBI Reference Sequence: NM_001037582.2). The primers utilized were: Forward 5′ GGTGTATAACTCTGACATG 3′ and Reverse 5′ CAGTTTACACATTACCAGTG 3′ for the wild type, Forward 5′ AAG TGA TCg TTA TGcAtC TTC 3′ and Reverse 5′ TCC AGA AGaTgC ATA AcG 3′ for the mutated seed (lower case letters indicate the mutated nucleotides). After sequence analysis, the amplified region was subcloned, either wild type or mutated, in the psiCHECK 2 vector (Promega, Madison, WI, USA) immediately downstream to the stop codon of the Renilla gene. The 293FT and Me1007 cell lines were transfected combining 40 ng of psiCHECK-3′UTR plasmid and 50 pmol of stability-enhanced miR-221 and/or miR-222 oligonucleotides or no targeting RNA control (Dharmacon Inc., Lafayette, CO, USA) with Lipofectamine 2000 (Life Technologies, Carlsbad, CA, USA). The Renilla activity was measured by using the Dual Luciferase assay (Promega Madison, WI, USA) normalized on the Luciferase level. The wt psiCHECK/SCD5 3′UTR cotransfected with the control non targeting oligonucleotide was considered as 100%.

For each genotype, genomic DNA was extracted from the leaves of one month-old plants using a modified CTAB method [26 ]. Isolated DNA was purified by RNase A treatment and phenol: chloroform: isoamyl alcohol precipitation following Sambrook et al. [27 ]. The quality and quantity of DNA were checked on agarose gel through a comparison with known quantities of λ Hind III DNA marker. The gene-primers that were specific for the sub-genome A (Hap-6A-P1_For and Hap-6A-P1_Rev) reported earlier were used to amplify the promoter region of gene TaGW2-6A [22 (link)]. PCR reactions were performed using a total volumes of 15 μl, with 3 pmol of each primer, 120 μM of each dNTP, 80 ng genomic DNA, 0.75 unit Jumpstart Accu Taq La DNA polymerase and 2 μl 10× buffer (Catalog number B0174), Sigma, USA. The PCR was carried out using Veriti Thermal Cycler, Applied Biosystem using the following profile with a ramp rate of 3.35°C/second: initial denaturation at 95°C for 3 min, followed by 32 cycles at 95°C for 30s, annealing at 58°C for 30s, and extension at 72°C 30s, with a final extension at 72°C for 10 min. PCR products were resolved by electrophoresis on 2% agarose gels.