GFP-neurofibromin (type 1 isoform) was cloned in pCDH-EF1a-EGFP-C2-IRES-Puro, a customized vector based on the parental vector pCDH-EF1-EGFP-C2-IRES-Puro from System Biosciences, with expression driven by the EF1a promoter. Cloning details will be presented elsewhere. An expression construct for HA-tagged RASA1 [63 (link)] was kindly provided by Christian Widmann, University of Lausanne, Switzerland. Neurofibromin was stably knocked down in HEK293T cells via lentiviral transduction of a shRNA construct. The targeting sequence GCTGGCAGTTTCAAACGTAA embedded in a miRNA scaffold was cloned into pLV-H1-SGIPZ, a customized lentiviral vector based on pGIPZ vector (Open Biosystems). The resulting pLV-H1-SGIPZ-NF1sh1miR, together with psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259), were transiently transfected into 293 T cells to produce lentiviral particles. 48 h post-transfection, the supernatant was harvested, filtrated through a 0.45 μM filter and used to infect 293 T cells. 48 h post-infection, puromycin selection was started to obtain the stable cell line. Transient transfections were performed using Polyethylenimine as described [64 (link)]. ON-TARGETplus siRNA-SMARTpool™ siRNAs were transfected using the Saint-Red transfection reagent from Synvolux Therapeutics exactly as described before [65 (link)].
Pgipz vector
Manufactured by Thermo Fisher Scientific
Sourced in United States
The PGIPZ vector is a plasmid-based expression system designed for gene silencing in mammalian cells. It contains a U6 promoter to drive the expression of short hairpin RNA (shRNA) for targeted gene knockdown. The vector also includes a puromycin resistance gene for selection of transfected cells.
Automatically generated - may contain errors
Lab products found in correlation
Puromycin, by Thermo Fisher Scientific (5 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (3 mentions)
Polybrene, by Merck Group (2 mentions)
Roscovitine, by Merck Group (2 mentions)
Azd5438, by Selleck Chemicals (2 mentions)
Arrest in transfection reagent, by Thermo Fisher Scientific (2 mentions)
Puromycin, by InvivoGen (2 mentions)
Pspax2, by Addgene (1 mentions)
Pmd2 g, by Addgene (1 mentions)
Sc 12984, by Santa Cruz Biotechnology (1 mentions)
Ab7291, by Abcam (1 mentions)
Ab23980, by Abcam (1 mentions)
Roti block, by Carl Roth (1 mentions)
Pgipz, by Thermo Fisher Scientific (1 mentions)
Rhs4346, by Horizon Discovery (1 mentions)
Puromycin, by Merck Group (1 mentions)
Dmem medium, by Thermo Fisher Scientific (1 mentions)
Camk2n1 human cdna clone, by OriGene (1 mentions)
Geneticin, by Thermo Fisher Scientific (1 mentions)
Sab4200135, by Merck Group (1 mentions)
25 protocols using pgipz vector
1
Cloning and Knockdown of Neurofibromin
2
Lentiviral REDD1 Knockdown in Keratinocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To knockdown REDD1 expression in keratinocytes, we used lentiviral construct expressing shREDD1 targeting REDD1 3′ UTR sequences homologous in human and mouse (clone V2LHS_176476, Thermo Scientific GIPZ Lentiviral shRNA Library). Empty pGIPZ vector (Open Biosystems, GE Healthcare Bio-Sciences, Pittsburgh, PA, USA) was used as a control.
3
LAPTM4b Knockdown in Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HeLa cells were transfected with either one of three LAPTM4b-specific shRNAs: V2LHS_175452 (targets LAPTM4b open-reading frame (ORF), V3LHS_340114 (targets ORF), V3LHS_405603 (targets 3′ untranslated region) or nonspecific shRNA all in the pGIPZ vector from Open Biosystems. V3LHS_405603 (shRNA 603) was used in all experiments, unless otherwise indicated. The cells were maintained in growth media supplemented with 1 μg ml−1 puromycin until colonies formed. For generating stable LAPTM4b knockdown in MDA-MB-231, HepG2 and BT549 cells lines: MDA-MB-231, HepG2 and BT549 cells were transfected with either shRNA to knockdown LAPTM4b (V3LHS_405603) or pGIPZ-Ctrl (control). Transfected cells were selected in Puromycin (0.25 μg ml−1 for MDA-MB-231 and 1 μg ml−1 for HepG2 and BT549) in DMEM+fetal bovine serum and antibiotics. Green fluorescent protein-positive colonies were selected and expanded as individual clones. LAPTM4b knockdown efficiency was monitored by quantitative PCR using the LAPTM4b unique primers from Integrated DNA Technologies (Supplementary Table 2 ).
4
Transcription Factor Knockdown Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Knockdown of TAL1, RUNX1 and GATA1 was achieved with shRNAs present in the pGIPZ vector (Open Biosystems) [17 (link)]. The accession numbers of the pGIPZ constructs is given in Supplementary Material . Controls were expressing non-targeting shRNA from the corresponding backbone. Knockdown was verified by qRT-PCR (Figure 5 ). A corresponding western blot from the same lysates showing the decreased protein amount of TAL1, RUNX1 and GATA1 is shown in [17 (link)]. For western blot analysis whole cell extracts from transfected HEK293 cells were used. Proteins were separated using SDS-PAGE and transferred to PVDF membranes. Membranes were blocked with Roti-Block (Carl Roth) and exposed to primary antibody dilution over night at 4°C. Afterwards membranes were incubated with appropriate secondary antibodies coupled to horseradish peroxidase (HRP) for 1h at room temperature. Signals were visualized using Western Super ECL reagent (Pierce) and analysed using X-ray film. Immunoblotting analysis was performed using anti-TAL1 (sc-12984, Santa Cruz), anti-RUNX1 (ab23980, Abcam), anti-GATA1 (sc-1233, Santa Cruz) and anti-Tubulin (ab7291, Abcam).
5
Silencing Stag2 in Mesenchymal Stem Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Stag2 short hairpin RNA (shRNA) sequences were generated by cloning into the lentiviral pGIPZ vector (Open Biosystems/GE Dharmacon, Lafayette, Colorado, USA). After testing several shRNAs, the clone bearing the target sequence 5’AGAACTTCTTCACTACTCT3’ was chosen for subsequent experiments. A scrambled nonsense control (Ctrl) shRNA with the target sequence 5’CTTACTCTCGCCCAAGCGAGAT3’ was cloned into the same lentiviral shuttle and used as a negative control. The constructs were transfected into human embryonic kidney (HEK 293) cells and the media was collected to obtain lentivirus. For infection of MSCs, the cells were seeded into 10 cm plates at a density of 2 × 106 cells/plate, and incubated with media containing lentivirus. Antibiotic-resistant cells were selected by puromycin (Invitrogen, Carlsbad, California, USA) and green fluorescence of the cells was checked by microscopy and flow cytometry.
6
MITF silencing in melanoma cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MITF silencing was carried out using the lentiviral vector pGIPz containing shRNAmir sequence V2LHS_257541 from Open Biosystems (Thermo Fisher Scientific, Huntsville, AL, USA). Two additional shRNAmir sequences were used: V2LHS_259964 and V2LHS_76565, from Open Biosystems. Non-silencing shRNAmir sequence (shNS), with no homology to known mammalian genes was used as control, cloned in a pGIPz vector (Open Biosystems). In order to carry out the MITF silencing in 501mel melanoma cell line over-expressing PEDF, parental cells were transduced with control lentiviral vector pRRL-GFP (GFP) or lentiviral vector expressing PEDF, pRRL-PEDF (PEDF) [7] (link), at 10 MOI. Seventy-two hours later, these melanoma cell lines were infected with shNS or shMITF lentiviral vectors at 100 MOI. For MITF over-expression we generated lentiviral constructs in the pCDH-CMV-MCS-EF1-copGFP (kindly provided by H. Rizos [21] (link)) encoding human MITF cDNA as indicated in Supplementary Methods.
7
Silencing MKP-2 in MCF7 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Four MKP-2 shRNAs subcloned into the pGIPZ vector (Open Biosystems) were tested. The MKP-2 targeting sequences were as follows: shRNA 1(RHS4430-101067857): CCCCAGTGGAAGATAACCACAA; shRNA 2 (RHS4430-101069298): ATTCGGTCAACGTGCGCTGTAA; shRNA 3 (RHS4430-101073316): ACTGGTTCATGGAAGCCATAGA; shRNA 4 (RHS4430-98713911): AGCCTACCTGATGATGAAGAAA. Constructs were transiently transfected into MCF7-MKP-2 cells using Lipofectamine 2000 according to the manufacturer's protocol. Non-silencing shRNA was used as a negative control.
8
Genetic Knockdown of Key Regulators
9
Generating Stable Mlip-Knockdown C2C12 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two mouse Mlip-shRNAmir sequences in the pGIPZ vector were purchased from Open Biosystems and non-silencing shRNAmir Control vector (Dharmacon RHS4346). Sequences included: V2LMM-214053 mature-sense: CCA ACT ACT TGC TAA ACT T (mm39 Chr9: 77009596-77009616) and V2LMM-211301 mature-sense: CCT ATA ATG CCT TCT ATT A (mm39 Chr9: 77009435-77009454). C2C12 cells in 60 mm plates were transfected with 4.0 µg of shRNAmir plasmid DNA or non-silencing shRNAmir Control vector using Arrest-In transfection (Open Biosystems) reagent in serum-free, antibiotic-free media. Control cells were generated using a validated non-silencing negative control expressed in the pGIPZ vector. Stable cell lines were established using puromycin (1.5 µg/mL) resistance selection.
10
Knockdown of Mouse ERα in PTEN-deficient Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Knockdown experiments were performed using the pGIPZ vector (Open Biosystems) containing either a non-silencing control shRNA or a mouse ERα shRNA (V2LMM_30677). Viral stocks were prepared from 293-T cells using the Trans-Lentiviral shRNA Packaging kit according to the manufacturer's instructions. PTEN-deficient cells were transduced, sorted for GFP expression and then maintained in medium supplemented with 4 μg/mL puromycin.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!