Opti mem

Manufactured by Horizon Discovery

Sourced in United States

Opti-MEM is a serum-reduced cell culture medium designed to maintain cell viability and support cell growth during various cell culture procedures. It is a proprietary formulation developed by Horizon Discovery to provide an optimal environment for cells in reduced serum conditions.

Automatically generated - may contain errors

Lab products found in correlation

22 protocols using opti mem

Knockdown of ANP32A and ANP32B in A549 cells and influenza virus infection

Check if the same lab product or an alternative is used in the 5 most similar protocols

Approximately 1 × 10⁶ A549 cells were transfected with 20 nM ON-TARGETplus Non-Targeting Control Pool (Dharmacon, D-001810-10-20) or 20 nM siGENOME Human ANP32A siRNA SMARTpool (Dharmacon, M-016060-00-0005) and siGENOME Human ANP32B siRNA SMARTpool (Dharmacon, M-020148-01-0005) using Lipofectamine RNAiMax and Opti-MEM according to the manufacturer’s instructions. Forty-eight hours posttransfection, cells were either lysed for Western blot analysis or infected with influenza A virus/WSN/33 (H1N1) virus.
For infections, cells were washed with PBS prior to infection, followed by infection with influenza A/WSN/33 (H1N1) virus at an MOI of 1 in DMEM supplemented with 0.3% BSA for 15 h. Total RNA was extracted using TRIzol (Invitrogen) and reconstituted in 20 μl of nuclease-free water.

Nilsson-Payant B.E., tenOever B.R, & te Velthuis A.J. (2022). The Host Factor ANP32A Is Required for Influenza A Virus vRNA and cRNA Synthesis. Journal of Virology, 96(4), e02092-21.

+ Open protocol

+ Expand

Knockdown of TRPV4 in HUVECs

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

To knockdown TRPV4, HUVECs at greater than 80% confluence in 60-mm dishes were used for transfection [46 (link)]. In brief, lipofectamine 2000 or lipofectamine 3000 (6 μl; Invitrogen) was mixed with Opti-MEM (250 μl; Invitrogen), and then siGenome siRNA human TRPV4 (25 nM, D-004195-03, GE Dharmacon, Lafayette, CO) or non-target control siRNA (25 nM) diluted in 250 μl Opti-MEM was added to the solution, mixed gently, and incubated at room temperature for 20 min. A total of 0.5 ml of this mixture was added to HUVECs in 4 ml Opti-MEM and incubated for 4 h. Then medium was changed back to M200 complete medium and cells were treated after 48 h after transfection.

Xu S., Liu B., Yin M., Koroleva M., Mastrangelo M., Ture S., Morrell C.N., Zhang D.X., Fisher E.A, & Jin Z.G. (2016). A novel TRPV4-specific agonist inhibits monocyte adhesion and atherosclerosis. Oncotarget, 7(25), 37622-37635.

+ Open protocol

+ Expand

Transfection of IHH-4 cells with siRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Transfection was performed following the manufacturer’s instruction. Briefly, IHH-4 cells were grown to 75% confluency on 60-mm dishes in RPMI1640 supplemented with 10% fetal calf serum. Lipofectamine-2000 (24 μL; Life Technology, Grand Island, NY) was mixed with 400 μL of serum- and antibiotic-free Opti-MEM (Life Technology) for each dish transfected, and allowed to sit at room temperature for 5 minutes. Simultaneously, 48 μL of each siRNA (GE Dharmacon, Lafayette, CO) was mixed with 800 μL of Opti-MEM (for each dish) and likewise incubated. The two suspensions were then combined and incubated for an additional 20 minutes at room temperature. After washing cell layers gently with phosphate bufferd saline (PBS), 1.2 mL of the mixture with the addition of 0.8 mL Opti-MEM was added to each dish, followed by incubation overnight (18 hours) at 37°C and 5% CO₂. Cells were then fed normal growth medium and used for experimentation as designed. Non-targeting control siRNA (GE Dharmacon) was used as a negative control.

Zheng H., Wang M., Jiang L., Chu H., Hu J., Ning J., Li B., Wang D, & Xu J. (2015). BRAF-Activated Long Noncoding RNA Modulates Papillary Thyroid Carcinoma Cell Proliferation through Regulating Thyroid Stimulating Hormone Receptor. Cancer Research and Treatment : Official Journal of Korean Cancer Association, 48(2), 698-707.

+ Open protocol

+ Expand

Tgm2 Overexpression and Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols

After seeding 2 × 10⁵ cells onto 12-well plates in Dulbecco’s Modified Eagle medium (DMEM) low glucose for 12 h, cells were transfected with either 2 μg of myc-DDK-Tgm2 wild-type (WT) or Tgm2-YF mutants with 2 μL of X-tremeGENE HP DNA transfection reagent (Roche Diagnostics) using OptiMEM (Thermo Fisher Scientific) according to the manufacturer’s protocol. OptiMEM was changed to DMEM low glucose medium after 12 h, and transfected cells were harvested after 48 h. For siRNA-mediated knockdown of Fyn and Tgm2, cells were transfected with siGENOME siRNA SMART pool using DharmafectDuo (Dharmacon, Thermo Scientific, Waltham, MA, USA) according to the manufacturer protocol. Briefly, 16 h after seeding 1.0 × 10⁵ cells onto 12-well plates, cells were transfected with either 0.2 μM of non-target siRNA or Fyn/Tgm2 siRNA with DharmafectDuo followed by harvesting for subsequent experiments after 48 h.

Uehara R., Yamada E., Okada S., Bastie C.C., Maeshima A., Ikeuchi H., Horiguchi K, & Yamada M. (2023). Fyn Phosphorylates Transglutaminase 2 (Tgm2) and Modulates Autophagy and p53 Expression in the Development of Diabetic Kidney Disease. Cells, 12(8), 1197.

+ Open protocol

+ Expand

Transfection of HUVECs with Tie1 and IFNAR1 siRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

HUVEC were transfected using Dharmafect (Dharmacon) and OPTI-MEM (ThermoFisher Scientific) following the manufacturer’s protocol. HUVEC were transfected with Dharmafect for 6 hours in OPTI-MEM serum-reduced medium with Tie1 and IFNAR1 and control non-targeting (Sc) siRNAs (all 100 nM, Dharmacon). OPTI-MEM media was changed to EGM™ media and experiments were performed 48–72 h after transfection. Efficiency of transfections was tested by qPCR and western blot and is shown in Supplementary Figure S1.

Rafael-Vidal C., Martínez-Ramos S., Malvar-Fernández B., Altabás-González I., Mouriño C., Veale D.J., Floudas A., Fearon U., Reigosa J.M, & García S. (2023). Type I Interferons induce endothelial destabilization in Systemic Lupus Erythematosus in a Tie2-dependent manner. Frontiers in Immunology, 14, 1277267.

+ Open protocol

+ Expand

Silencing RAB3A and RAB11B in Melan-ink4a Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Melan-ink4a melanocytes were cultured at 8.5 × 10⁴ cells/well in 12-well plates. Whereas 50 nM of SMART pool siRNAs (Thermo Fisher Scientific, Lenexa, Kansas) (Table 1) were added to 250 μl of Opti-MEM (Gibco), 2.5 μl of DharmaFECT 4 (Dharmacon, Lafayette, Colorado) were added to 250 μl of Opti-MEM. After 5 minutes of incubation at room temperature, the two mixtures were combined, mixed gently, and incubated for 20 minutes at the same temperature. The growth medium from cells seeded the day before transfection was removed and replaced by the siRNA mixture in a total volume of 500 μl in Opti-MEM. Cells were incubated for 24 hours at 37 °C, and then the medium was changed to 1 ml of complete RPMI, DMEM, or KCM supplemented with 200 pM cholera toxin and 200 nM phorbol myristate acetate. After 3 days, cells were assayed, and silencing efficiency was confirmed by qPCR.Table 1

List of SMART pool siRNAs Used

siRNAs	Species	Sequences (5′‒3′)
RAB3A	Mouse	CCACUCAGAUCAAAACUUAUGUCAGCACCGUUGGCAUAGGACGUGAUCUGUGAGAAGCCAUCUACCGCAACGACAA
RAB11B	Mouse	ACAGAAAUCUACCGUAUUG CGAGUACGAUUACCUAUUC GCAGAUAGCAACAUUGUCA GUGCACUGCUGGUAUAUGA
Control	Mouse	GAAGAUAUCGUCCGCAUUA GUUGAAAUUUGACCAGUUA GAACUUAGCAGGAGAGAGU CUUCAGAUGUGUUCAAGAA

Abbreviation: siRNA, small interfering RNA.

Cabaço L.C., Bento-Lopes L., Neto M.V., Ferreira A., Staubli W.B., Ramalho J.S., Seabra M.C, & Barral D.C. (2022). RAB3A Regulates Melanin Exocytosis and Transfer Induced by Keratinocyte-Conditioned Medium. JID Innovations, 2(5), 100139.

+ Open protocol

+ Expand

siRNA Transfection of XB2 Keratinocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols

XB2 keratinocytes (1 × 10⁵ per well) were seeded in 24‐well plates (Corning, NY, USA). Twenty‐four hours later, 50 nM of gene‐specific siGenome SMART pool (Thermo Fisher Scientific) was diluted in 32 μl Opti‐MEM (Gibco), while 1.2 μl of Dharmafect 1 (Dharmacon, GELifeScience) was added to 6 μl of Opti‐MEM. These mixtures were combined and incubated at room temperature for 20 min. Finally, 160 μl of Opti‐MEM was added to the mixture, the medium was removed from the cells, and the siRNA mixture added to each well. Cells were incubated for 24 h at 37°C and then the medium was changed to complete medium. Non‐targeting siRNA pool (Thermo Scientific) was used as control.

Moreiras H., Bento‐Lopes L., Neto M.V., Escrevente C., Cabaço L.C., Hall M.J., Ramalho J.S., Seabra M.C, & Barral D.C. (2022). Melanocore uptake by keratinocytes occurs through phagocytosis and involves protease‐activated receptor‐2 internalization. Traffic (Copenhagen, Denmark), 23(6), 331-345.

+ Open protocol

+ Expand

Silencing Mouse MCU Gene in Cell Cultures

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mouse MCU (siGENOME; #062849-01) and negative control (#SN-1002) siRNAs were purchased from Dharmacon (USA) and Bioneer (Korea), respectively. Cells were seeded on to a 6-well plate 24 h before siRNA transfection. Before the transfection, cells were washed twice with PBS and maintained in DMEM. Transfection was conducted using OptiMEM and Dharmafect 1 transfection reagent (#T-2001-03; Dharmacon) following the manufacturer’s guideline. Twenty-four hours after transfection, OptiMEM was replaced by complete medium. Cells were maintained 72 h before treatment with palmitate.

Ly L.D., Ly D.D., Nguyen N.T., Kim J.H., Yoo H., Chung J., Lee M.S., Cha S.K, & Park K.S. (2020). Mitochondrial Ca2+ Uptake Relieves Palmitate-Induced Cytosolic Ca2+ Overload in MIN6 Cells. Molecules and Cells, 43(1), 66-75.

+ Open protocol

+ Expand

Knockdown and Overexpression of HHIP and PKM2 in ASMCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

For siRNA knockdown experiments, according to the manufacturer's instructions (Dharmacon, Lafayette, CO), ASMC cells were transfected with 20 nM ON-TARGETplus SMARTpool siRNA (si-HHIP, si-PKM2) or 20 nM siCONTROL NON-TARGETINGpool siRNA (Dharmacon, Lafayette, CO) for 48 h using Opti-MEM and Lipofectamine RNAiMAX. For overexpression experiments, CMV-HA-FLAG vector or HHIP-HA-FLAG plasmid at the concentration of 0.5 μg/ml were transfected into ASMCs using Lipofectamine 3000 Reagent (Invitrogen, Thermo Fisher Scientific) followed by culture medium change after 8 h of transfection. RT-qPCR or Western blot was performed to assess transfection efficiency.

Li Y., Zhang L., Polverino F., Guo F., Hao Y., Lao T., Xu S., Li L., Pham B., Owen C.A, & Zhou X. (2021). Hedgehog interacting protein (HHIP) represses airway remodeling and metabolic reprogramming in COPD-derived airway smooth muscle cells. Scientific Reports, 11, 9074.

+ Open protocol

+ Expand

Silencing Piezo1 in Cardiac Fibroblasts

Check if the same lab product or an alternative is used in the 5 most similar protocols

Murine cardiac fibroblasts were grown to 80% confluence and transfected with 10 nm Piezo1-specific Silencer Select Pre-Designed siRNA (4390771, siRNA s107968, Life Technologies) or Silencer Select Negative Control No. 1 siRNA (4390843, Life Technologies) using Lipofectamine RNAiMAX reagent (Life Technologies) in Opti-MEM (Gibco) according to the manufacturer's instructions. Medium was replaced with full-growth medium 24 h later. For human cardiac fibroblasts, cells were grown to 90% confluence and transfected with 20 nm Piezo1-specific Silencer Select Pre-Designed siRNA (4392420, siRNA s18891, Thermo Fisher Scientific) or ON-TARGETplus Nontargeting Pool siRNA (D-01810-10-20, Dharmacon) using Lipofectamine 2000 in Opti-MEM according to the manufacturer's instructions. Medium was replaced with full-growth medium after 4.5 h. Cells were used for experimentation 48 h after transfection.

Blythe N.M., Muraki K., Ludlow M.J., Stylianidis V., Gilbert H.T., Evans E.L., Cuthbertson K., Foster R., Swift J., Li J., Drinkhill M.J., van Nieuwenhoven F.A., Porter K.E., Beech D.J, & Turner N.A. (2019). Mechanically activated Piezo1 channels of cardiac fibroblasts stimulate p38 mitogen-activated protein kinase activity and interleukin-6 secretion. The Journal of Biological Chemistry, 294(46), 17395-17408.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!