Brilliant sybr green qpcr master mix

For this knockdown experiment, shrimp were randomly divided into 3 groups and injected with LvRheb dsRNA, EFGP dsRNA, or PBS. At 3 days post dsRNA injection, shrimp were then challenged with WSSV. Four pooled hemocyte samples were collected from each group at various time points (12, 24, 36, and 48 hpi), with each pooled sample taken from 3 shrimp. Total cDNA was then prepared from each sample as described above. To quantify the relative expression of the WSSV ie1 and vp28 genes, real-time PCR was performed with the specific primers IE1-qF/IE1-qR, VP28-qF/VP28-qR, and EF1-α-qF/EF1-α-qR (Table S3) using the Bio-Rad detection system with Brilliant SYBR Green QPCR master mix (Applied Biosystems). Data values were calculated by the 2^−ΔΔCT method. Statistically significant differences between groups were analyzed by Student's t-test.

Total RNA from cardiac human tissue was homogenized in RNA-Bee (Amsbio, Abbingdon, UK) and the Phenol/Chloroform (Roth, Karlsruhe, Germany) extraction protocol was used for the RNA isolation. The Caliper LabChip bioanalyzer (Agilent Technologies, Ratingen Germany) was used to analyze the purity of the isolated RNA. Quantitative real-time PCR were performed using the Brilliant SYBR Green qPCR master mix (Applied Biosystems, Foster City, CA, USA). The relative amount of target mRNA was determined using the comparative threshold (Ct) method as previously described [34 (link)]. The mRNA contents of target genes were normalized to the expression of hypoxanthine phosphoribosyl transferase (HPRT).

The total RNA from cardiac rat tissue was isolated with RNA-Bee (Amsbio, UK) and a quantitative real-time PCR was performed with Brilliant SYBR Green qPCR master mix (Applied Biosystems, USA). The relative amount of target mRNA was determined using the comparative threshold (Ct) method as previously described (53 (link)). The mRNA contents of target genes were normalized to the expression of hypoxanthine phosphoribosyl transferase (HPRT).

Total RNA from the breast carcinoma tissue (non-IBC and IBC), control and Sdc-1 siRNA transfected SUM-149 cells was extracted using the RNA Purification Kit GeneJET (Thermo scientific, ON, Canada) and reverse transcribed into complementary DNA (cDNA) using High-Capacity cDNA Reverse Transcription Kit (Thermo scientific, ON, Canada). qPCR was performed using Brilliant SYBR Green qPCR master mix (Applied Biosystems, San Francisco, CA, USA) in a Step One Plus Real-Time PCR System (Applied Biosystems, San Francisco, CA, USA). The relative gene transcript expression was assessed using the 2^-ΔΔCt method after normalization to expression of GAPDH or 18S rRNA (Qiagen, Valencia, CA, USA). Primer sequences used according to the published literature as follows: IL-23 5’-TCTCCTTCTCCGCTTCAAAATC-3’ (forward) and 5`-GGCGGCTACAGCCACAAA-3`(reverse); for IL-17A 5'- TCCCACGAAATCCAGGATGC -3`(forward) and 5`- GGATGTTCAGGTTGACCATCAC-3' (reverse); for Sdc-1 5`-TACTAATTTGCCCCCTGAAGAT-3`(forward) and 5`-CAAGGTGATATCTTGCAAAGCA-3`(reverse). For DLL4 detection, we employed ABI Master-Mix and the predesigned TaqMan gene expression systems Hs00184092 m1 (DLL4) and Hs99999901_s1 (18S rRNA) (Applied Biosystems, San Francisco, CA, USA).

RNA was isolated from FFPE sections using PureLink FFPE Total RNA Isolation kit (Invitrogen, cat. K156002), in accordance with the manufacturer’s instructions. RNA samples were quantified spectrophotometrically and loaded onto 1.5% agarose gel to visualize the degree of RNA integrity. The reverse transcription was carried out with Thermo Scientific RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, cat. K1622) in accordance with the manufacturer’s instructions. Gene expression was evaluated with specific primers for PKM2, SHMT2, HIF-1α, and IL-6 (all from Qiagen) by a CFX Connect™ Real-Time PCR Detection System (BioRad Laboratories) using a SYBR-Green fluorophore based real-time reaction (Brilliant SYBR Green QPCR Master Mix, Thermo Fisher Scientific). Gene expression analysis was performed using CFX Manager™ Real Time PCR Detection System Software, Version 3.1 (BioRad).

Total RNA was isolated from mouse cortex with a NucleoSpin RNA II mini kit following the manufacturer’s instructions (Macherey-Nagel, Germany). Synthesis of cDNA was performed on 0.5 μg RNA using the RevertAid First Strand cDNA Synthesis KIT (Thermo Scientific, USA). For qPCR, 100 ng cDNA served as a template for PCR amplification using Brilliant SYBR Green QPCR Master Mix following the manufacturer’s instructions (Thermo Scientific).