Synthesized oligonucleotides containing the S1 and M2 shRNA sequences with BamH I or Hind III sequences at the 5′ or 3′ termini were designed as illustrated in Table 2 according to the instructions of the manufacturer of RNAi Designer (Invitrogen, Carlsbad, CA, USA). The two complementary oligonucleotides were annealed and inserted into the BamH I/Hind III site of the pSilencer-3.0-H1 vector. After transformation, clone PCR and enzyme digestion, the identified shRNA expression plasmids were sent for sequence analysis for further confirmation and were subsequently designated pSilencer-S and pSilencer-M.
Rnai designer
Manufactured by Thermo Fisher Scientific
Sourced in United States, China
The RNAi Designer is a software tool that assists in the design of small interfering RNA (siRNA) sequences for gene silencing experiments. The core function of the RNAi Designer is to generate candidate siRNA sequences that target specific genes of interest, while adhering to design guidelines to optimize the potential for effective gene knockdown.
Automatically generated - may contain errors
Lab products found in correlation
Block it pol 2 mir rnai expression vector kit, by Thermo Fisher Scientific (4 mentions)
Pcdna6.2 gw emgfp mir, by Thermo Fisher Scientific (3 mentions)
Pgreenpuro vector, by System Biosciences (3 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions)
Ppackh1 lentivector packaging kit, by System Biosciences (2 mentions)
Block it pol 2 mir rnai kit, by Thermo Fisher Scientific (1 mentions)
Quikchange, by Agilent Technologies (1 mentions)
Plvthm, by Addgene (1 mentions)
Pcdna6.2 gw emgfp mir vector, by Thermo Fisher Scientific (1 mentions)
One shot top10 chemically competent e coli, by Thermo Fisher Scientific (1 mentions)
Blasticidin, by Thermo Fisher Scientific (1 mentions)
Block it pol 2 mir rnai, by Thermo Fisher Scientific (1 mentions)
Non targeting control sirna, by Merck Group (1 mentions)
Block it, by Thermo Fisher Scientific (1 mentions)
Bsrgi, by New England Biolabs (1 mentions)
T4 dna ligase, by New England Biolabs (1 mentions)
24 protocols using rnai designer
1
Plasmid Construction for RNAi
2
Generating Artificial miRNAs for HDAC4
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To express artificial microRNAs (miRNAs), we used a BLOCK-iT Pol II miR RNAi system (Invitrogen), and followed the protocol explicitly. The human miRNA sequences were chosen from the RNAi designer (Invitrogen) with only ‘5 star’ sequences chosen, and then annealed into duplexes and inserted into the linearized miRNA expression vector pcDNA6.2-GW/ EmGFP-miR according to the manufacturer’s protocol (Invitrogen). For HDAC4, sequence #2 was a chained set of two different miRNAs (following the manufacturer’s protocol) including the one used in sequence #1.
Two miRNA hairpins were designed against human HDAC4 (GenBank: NM_006037.3):
Sequence#1 (start:566): top strand (mature miR-RNAi sequence in blue)
5′TGCTGAAATGCAGTGGTTCAGATTCCGTTTTGGCCACTGACTGACGGAATCTGCCACTGCATTT-3′
Sequence#1:bottom strand (complement in red)
5′CCTGAAATGCAGTGGCAGATTCCGTCAGTCAGTGGCCAAAACGGAATCTGAACCACTGCATTTC -3′
Sequence#2 (start:732): top strand (mature miR-RNAi sequence in blue)
5′TGCTGTTCAGATTCGGTTCAGAAGCTGTTTTGGCCACTGACTGACAGCTTCTGCCGAATCTGAA -3′
Sequence#2:bottom strand (complement in red)
5′CCTGTTCAGATTCGGCAGAAGCTGTCAGTCAGTGGCCAAAACAGCTTCTGAACCGAATCTGAAC -3′.
Two miRNA hairpins were designed against human HDAC4 (GenBank: NM_006037.3):
Sequence#1 (start:566): top strand (mature miR-RNAi sequence in blue)
5′TGCTGAAATGCAGTGGTTCAGATTCCGTTTTGGCCACTGACTGACGGAATCTGCCACTGCATTT-3′
Sequence#1:bottom strand (complement in red)
5′CCTGAAATGCAGTGGCAGATTCCGTCAGTCAGTGGCCAAAACGGAATCTGAACCACTGCATTTC -3′
Sequence#2 (start:732): top strand (mature miR-RNAi sequence in blue)
5′TGCTGTTCAGATTCGGTTCAGAAGCTGTTTTGGCCACTGACTGACAGCTTCTGCCGAATCTGAA -3′
Sequence#2:bottom strand (complement in red)
5′CCTGTTCAGATTCGGCAGAAGCTGTCAGTCAGTGGCCAAAACAGCTTCTGAACCGAATCTGAAC -3′.
3
Knockdown of Gadd45b in Mouse Neuroblastoma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Knockdown (KD) constructs designed to target Gadd45b mRNA were cloned using BLOCK-iT Pol II miR RNAi kit (Invitrogen). Briefly, four artificial miRNA oligonucleotides were designed using Invitrogen’s RNAi Designer (www.invitrogen.com/rnai ) to KD Gadd45b and cloned into pcDNA6.2-GW. Mouse neuroblastoma (N2a) cells were transfected using lipofectamine 2000 (Invitrogen) with the different plasmids designed to target Gadd45b or LacZ as control. The level of Gadd45b mRNA KD was assessed using qRT-PCR 24 hr after transfection. The miRNA causing the most efficient downregulation was further Gateway cloned (Invitrogen) into the p1005 + HSV vector.
4
AC3 Silencing Using miR RNAi Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Silencing of AC3 has been performed using BLOCK-iT Pol II miR RNAi Expression Vector kits (Invitrogen) and the RNAi Designer (Invitrogen). The sequences of the single-stranded oligos are AC3.3: top: TGCTGTTAGGATGGAGCACACGGCATGTTTTGGCCACTGACTGACATGCCGTGCTCCATCCTAA; bottom: CCTGTTAGGATGGAGCACGGCATGTCAGTCAGTGGCCAAAACATGCCGTGTGCTCCATCCTAAC. The double-stranded oligos were inserted in a pcDNA 6.2-GW/EmGFP-miR. To produce the pcDNA6.2-GW/Tdtomato-miR, GFP was replaced by tdTomato using Dra1 and Bam HI. The resulting constructions were sequenced before use.
5
Engineered miRNAs Target Caspase-1 and NLRP3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For miR specific for caspase-1 and NLRP3, target sequences were designed using Invitrogen’s RNAi Designer (http://rnaidesigner.lifetechnologies.com/rnaiexpress ). The double-stranded DNA oligonucleotides were synthesized and cloned into the parental vector pcDNA6.2-GW/EmGFP-miR (Invitrogen, Carlsbad, CA). The expression cassette for miR was moved into the pENTR/CMV vector and adenovirus was made as previously reported46 (link). The miR sequences were as follows: caspase-1, top strand 5′-TGCTGAGAAAGTACTCCTTGAGAGTCGTTTTGGCCACTGACTGACGACTCTCAGAGTACTTTCT-3′ and bottom strand 5′-CCTGAGAAAGTACTCTGAGAGTCGTCAGTCAGTGGCCAAAACGACTCTCAAGGAGTACTTTCTC-3′; NLRP3, top strand 5′-TGCTGATCACAGTGGGATTCGAAACAGTTTTGGCCACTGACTGACTGTTTCGACCCACTGTGAT-3′ and bottom strand 5′-CCTGATCACAGTGGGTCGAAACAGTCAGTCAGTGGCCAAAACTGTTTCGAATCCCACTGTGATC-3′.
6
Investigating MAN2A1 Gene Silencing in Swine Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
According to the CDS region sequence of the pig MAN2A1 gene (NCBI accession number: XM003123823.6), three shRNA sequences targeting the MAN2A1 gene were designed using Invitrogen RNAi Designer software (Table S2 ). Recombinant vectors (MAN2A1-sh1, MAN2A1-sh2, MAN2A1-sh3, and shRNA-NC) were constructed and transfected into 3D4/21 cells, and G418 (600 mg/mL) was added to cells after the cells were transfected for 24 h. When the cells stably expressed green fluorescent protein, the cell total RNA was extracted and cDNA was synthesized. Then the expression of MAN2A1 gene was detected by qPCR and the expression of MAN2A1 protein was detected by Western blot.
H1N1 and H3N2 were used to infect 3D4/21 cells in different treatment groups (MAN2A1-shRNA group, and NC group). After cells were infected for 48 h, the cell total RNA was collected for qPCR analysis, and the cell culture supernatant was collected for ELISA analysis.
H1N1 and H3N2 were used to infect 3D4/21 cells in different treatment groups (MAN2A1-shRNA group, and NC group). After cells were infected for 48 h, the cell total RNA was collected for qPCR analysis, and the cell culture supernatant was collected for ELISA analysis.
7
Knockdown and Rescue of FGF14 in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
shRNAs targeted to FGF14 were designed with Invitrogen's RNAi Designer as previously described (Yan et al., 2013 (link)) and the sequences were cloned into pLVTHM (Addgene). After evaluating several candidates, we found that the most effective shRNA sequence was 5′ CGCGTGGAGGCAAACCAGTCAACAAGTGCATTCAAGAGATGCACTTGTTGACTGGTTTGC CTCCTTTTTTAT 3′, which was used for the experiments described here. The scrambled shRNA which bears no homology to genes in the rodent genome (Wang et al., 2011 (link)) has the sequence: 5′-CGCGTGACCCTTAGTTTATACCTATTCAAGAGATAGGTATAAACTAAGGGTCTTTTTTAT-3′. FGF14 rescue and overexpression experiments were performed with FGF14 constructs (either full-length or with the N-terminus truncated) cloned into pcDNA3.1 also containing tdTomato. Mutagenesis to obtain FGF14bR/A was performed using QuikChange (Agilent). All plasmids were verified by sequencing.
8
Silencing Hsp25 and Wnt-5a in Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
YAMC cell Hsp25 was silenced as previously described using a silencing oligonucleotide (bases 539–564, GenBank. NM_013560) designed using RNAi designer (Invitrogen). For VUPF myofibroblast Wnt-5a silencing, a silencing oligonucleotide (exons 4, 5 Ambion ID#187053, Austin, TX) or scrambled oligonucleotide (ID#4611) was used.
9
Silencing CEMP1 Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
siRNA sequences for CEMP1 (NM_001048212.3; GI:313677962) were designed using Invitrogen’s RNAi Designer. The synthesized complementary DNA oligos (Invitrogen, Carlsbad, CA, USA), were annealed to generate a double-stranded oligo and cloned into the linearized pcDNA 6.2-GW/EmGFP-miR vector (Invitrogen, Carlsbad, CA, USA), using T4 DNA ligase. The Neg-miRNA control plasmid was included in the Block-iT-Pol II miR RNAi Expression Vector Kit. All of the vectors were transformed into One Shot TOP10 Chemically Competent E. coli (Invitrogen, Carlsbad, USA), and the colonies containing spectinomycin-resistant transformants were further analyzed for the desired expression. The recombinant vectors were purified with a purification kit (Invitrogen, Carlsbad, USA) and confirmed by sequencing.
10
Silencing ANGPTL2 and CXCR4 in MDA-MB231 cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MDA-MB231 cells were transfected with ANGPTL2-specific small interfering RNA vectors and control vectors26 (link) using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol. MicroRNAi constructs were made using the BLOCK-iT Pol II miR RNAi expression vector kit, according to the manufacturer's instructions (Invitrogen). For microRNA synthesis, a single stranded-DNA oligo encoding a pre-miRNA and a strand encoding its complement were designed using the Invitrogen RNAi Designer website: ANGPTL2 (top) 5′-GATCCGGAGCCCTCACTCTCCAGATTCGAAGCTTGGAATCTGGAGAGTGAGGGCTCTTTTTTGGAAG-3′ and ANGPTL2 (bottom) 5′-GCCTCGGGAGTGAGAGGTCTAAGCTTCGAACCTTAGACCTCTCACTCCCGAGAAAAAACCTTCTTAA-3′, CXCR4 (top) 5′-TGCTGTAAACATCACAACTGGACTCGGTTTTGGCCACTGACTGACCGAGTCCATGTGATGTTTA-3′ and CXCR4 (bottom) 5′-CCTGTAAACATCACATGGACTCGGTCAGTCAGTGGCCAAAACCGAGTCCAGTTGTGATGTTTAC-3′. Stable lines were selected in 20 μg/ml Blasticidin (Invitrogen).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!