This method has been reported in our recent study [2 (link)]. Briefly, the collected intervertebral disc tissue was transported to laboratory using 0.9% sterile saline within two hours. Then, the tissue was washed 3 times using PBS (Servicebio, Wuhan, China) in super clean bench. Next, gel-like NP tissue was separated and digested using 0.25% Trypsin-EDTA (C0209-100 mL, Beyotime, Shanghai, China) for 30 minutes and 0.2% collagenase type II (Invitrogen, USA) for another 1 h at 37°C under a shaker (70 r/min). Finally, the isolated NP cells were resuspended in complete culture medium (Gibco; Thermo Fisher Scientific, Inc.) and cultured in a 37°C incubator. At the third, half of the culture medium will be replaced by complete medium. Five days after isolation, the spindle-shaped NP cells will move out and adhered at the bottom which we called passage 0. When the cell density reaches about 80%, the NP cells could be used further experiments.
Complete culture medium
Manufactured by Thermo Fisher Scientific
Sourced in United States
Complete culture medium is a laboratory reagent designed to support the growth and maintenance of cells in cell culture. It provides the necessary nutrients, growth factors, and other components required for cell viability and proliferation.
Automatically generated - may contain errors
Lab products found in correlation
Propidium iodide, by Thermo Fisher Scientific (3 mentions)
Hoechst 33342, by Thermo Fisher Scientific (2 mentions)
Collagenase type 2, by Thermo Fisher Scientific (1 mentions)
Phosphate buffered saline (pbs), by Wuhan Servicebio Technology (1 mentions)
Trypsin edta, by Beyotime (1 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (1 mentions)
Matrigel, by BD (1 mentions)
Transwell plate, by Corning (1 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (1 mentions)
Lipofectamine 2000 reagent, by GenePharma (1 mentions)
Penicillin streptomycin solution, by Thermo Fisher Scientific (1 mentions)
Scrambled control sirna, by Genechem (1 mentions)
Verapamil, by MedChemExpress (1 mentions)
24 well ultra low cluster plates, by Corning (1 mentions)
Moflo xdp cell sorter, by Beckman Coulter (1 mentions)
9 protocols using complete culture medium
1
Isolation and Culture of Intervertebral Disc Nucleus Pulposus Cells
2
Culturing Laryngeal Cancer Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Laryngeal cancer cell lines Tu212, LCC-1, and LNN-1 and normal cell line HaCat were purchased from the Beijing Institute of Basic Medicine, China. 10% fetal bovine serum was dissolved in RPMI1640 medium (Gibco, MA, USA) and made into complete culture medium (Gibco, MA, USA), which was adopted to culture LCC and LLN cells. All cells were cultured in 37°C 5% CO2 incubator. All cell lines were identified by STRDNA map, and mycoplasma (GENEWIZ Co, Ltd., Suzhou, China) was detected within 6 months.
3
Isolation and Characterization of rPDLCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
rPDLCs were isolated and characterized as described in the previous study [24 (link)]. A complete culture medium (all from Gibco, Life sciences; Thermo Fisher Scientific, Waltham, MA, USA) was used for culturing rPDLCs at 37 °C and 5% CO2 in a humidified chamber. The media was changed two times per week. After 70% to 80% confluence was reached, trypsin-EDTA (0.25%) was used to detach the adherent cells. Only cells from P4-P6 were used in the current study.
4
Transwell-based Cell Invasion Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Matrigel (25 μL; BD Biosciences) and 200 μL of the cell suspensions were added into the upper chambers of Transwell plates (Corning, NY, USA). Complete culture medium (700 μL; Gibco) was added into the subchambers of the Transwell plates. The cells were incubated for 24 hrs, then stained with crystal violet solution for 30 mins. Images were captured to evaluate the cell invasion ability.
5
Culture and Differentiation of BMSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
BMSCs from the fth generation were seeded in 6-well plates coated with poly ornithine and laminin at a density of 2 × 10 5 cells/ml. After 24 h, the DMEM/F12 medium were replaced with complete culture medium (Gibco, USA) containing 10 ng/ml bFGF. The complete culture medium was changed every 2 to 3 days. BMSCs in control group were not induced.
6
Neural Lineage Differentiation of BMSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
BMSCs from the fifth generation were seeded in 6-well plates coated with poly ornithine and laminin at a density of 2×10 5 cells/mL. After 24 h, respectively, the DMEM/F12 medium were replaced with complete culture medium (Gibco, USA) containing 10 ng/mlL bFGF to induced as neurons, or 1% N 2 and 2% B27 to induced as astrocytes, or 2 mM glutamine, 50 U/mL penicillin, 50 U/mL streptomycin, and 60 μg/mL T3 to induced as oligodendrocytes. The complete culture medium was changed every 2 to 3 days. BMSCs in control group were not induced.
7
Overexpression and Knockdown of miR-217 in NSCLC Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
pcDNA3.1 or pcDNA3.1-SIRT1 reconstructed vectors (Guangzhou RiboBio Co., Ltd.) were transfected into H1299 and A549 cells using Lipofectamine® 2000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol.
For the mimic transfections, cells were seeded into 6-well plates at a density of 1×105 cells/well and cultured in complete culture medium (Thermo Fisher Scientific, Inc.) overnight at 37°C with 5% CO2. Following incubation, 50 nM miR-217 mimic or miR-negative control (NC) mimic (Shanghai GenePharma Co., Ltd.) were transfected into H1299 and A549 cells using Lipofectamine® 2000 reagent, according to the manufacturer's protocol. Following incubation for 24 h at 37°C, cells were harvested for subsequent experimentation.
For the mimic transfections, cells were seeded into 6-well plates at a density of 1×105 cells/well and cultured in complete culture medium (Thermo Fisher Scientific, Inc.) overnight at 37°C with 5% CO2. Following incubation, 50 nM miR-217 mimic or miR-negative control (NC) mimic (Shanghai GenePharma Co., Ltd.) were transfected into H1299 and A549 cells using Lipofectamine® 2000 reagent, according to the manufacturer's protocol. Following incubation for 24 h at 37°C, cells were harvested for subsequent experimentation.
8
Leptin Receptor Silencing in MOLT-3 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Leptin receptor specific siRNA and scrambled control siRNA were purchased from GeneChem, Inc. (Daejeon, Korea). The sequence of siRNA: ObR-RNAi-a: 5′-Ccgg, stem gcCTATGAGCAAAGTAAATAT, loop CTCGAG, stem ATATTTACTTTGCTCATAGGC, 3′-TTTTTg; ObR-RNAi-b: 5′aattcaaaaa, stem gcCTATGAGCAAAGTAAATAT, loop CTCGAG, stem ATATTTACTTTGCTCATAGGC. The sequence of control siRNA: TTCTCCGAACGTGTCACGT. MOLT-3 cells were plated in 60 mm culture dish for 24 h prior to transfection. Complete culture medium (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA), supplemented with FBS, and Penicillin-Streptomycin Solution (cat. no. 15140-122; Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) was freshly added to each well 2 h before transfection. Next, the cells were treated using ObR siRNA or scrambled control siRNA (1 µl; dilution, 1:100), the ratio of Nanofectin transfection reagent (ExCell Biology, Inc., Shanghai, China): DNA was 1:1. After 24 h, the transfection efficiency was checked by western blot analysis with ObR expression.
9
Isolation and Culture of Side Population Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Side population (SP) cells of A549 or PC9 were analyzed and sorted using the method described by Maria M. Ho16 (link). Briefly, 1 × 106 cells were labeled with 5 µg/ml Hoechst33342 (Thermo Fisher Scientific) alone or in combination with 50 µg/ml verapamil (MedChemExpress, Monmouth Junction, NJ). Then the cells were centrifuged and suspended in a culture medium containing 2% FBS, and incubated with 1 μg/ml propidium iodide (Thermo Fisher Scientific). SP analysis and sorting were done on MoFlo XDP cell sorter (Beckman, Brea, CA). Isolated SP cells were seeded into 24-well Ultra Low Cluster plates (Corning) and cultured in a complete culture medium (ThermoFisher Scientific) containing DMEM/F12 (1:1), EGF (20 ng/mL), bFGF (20 ng/mL), and B27 (2%). After 10-14 days, spheres were counted under an inverse microscope.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!