Pcr clean up and gel purification kit

For epitope cloning, the light chain vector was originally designed as an empty vector with a spacer epitope flanked by Type IIS BsmBI restriction sites to facilitate scar-free cloning (GAGACGACCTGGTGCCGATGATATCATCGATGGTGGCGACCGTCGTCTC; BsmBI sites underlined). The empty light chain vector is BsmBI digested, electrophoresed on a 0.8% agarose gel, and then gel purified using a PCR clean up and gel purification kit (Macherey Nagel). The epitope encoding sequences are designed as annealed primer pairs with overhangs complementary to the overhangs left by BsmBI digestion. The annealed primers for the coding sequences used for each epitope in this study are as follows (BsmBI overhangs underlined): HPV E7_49–57: GGCCAGAGCCCATTACAATATTGTAACCTTTGCGG; IAV_NP_366–374: GGCCGCGTCTAACGAAAATATGGAAACCATGGCGG; LCMV_P14 (GP_33–41): GGCCAAGGCCGTGTACAACTTCGCCACCATGGCGG. Ligation is performed using the Rapid DNA Ligation kit (Roche) and is carried out with a 5X molar ratio of annealed epitope to digested vector. The ligation mixture is incubated for 5 min at room temperature (RT), then transformed into Stellar Competent Cells (E. coli HST08; Clontech). Colonies are selected on LB agar plates with kanamycin. Individual colonies are picked, grown in 2XYT broth with kanamycin, sequenced, and DNA stocks are prepared from sequence-confirmed colonies.