Multimode 5 microscope

The 514-bp undamaged DNA substrate was made by PCR from pSCW01 plasmid using the forward primer 5′- GCATTGCTGAGGGTTATTGTC -3′ and reverse primer 5′- TATCCGGTAAGCGGCAGG -3′. The PCR products were purified with QIAquick PCR purification kit (QIAGEN) and eluted in filtered deionized water.
To obtain AFM images, the purified Rad4–Rad23 complex used for crystallization (2 μM) was incubated with the 514-bp undamaged DNA substrate (400 nM) in binding buffer of 5 mM BTP-HCl, 160 mM NaCl, 5% glycerol and 0.74 mM 3-[(3-cholamidopropyl) dimethylammonio]-1-propanesulfonate (CHAPS), pH 6.8. Reaction mixtures were incubated at room temperature for 20 min and diluted by 1:80 in AFM deposition buffer of 25 mM sodium acetate, 25 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid–potassium hydroxide (HEPES-KOH, pH 7.5) and 10 mM magnesium acetate. Ten μl of the dilution was deposited onto freshly cleaved mica, rinsed with deionized water and dried under a gentle stream of nitrogen gas. Images were collected by a MultiModeV microscope (Bruker Corporation) in an E scanner in tapping mode. Images were captured at a scan size of 1 μm × 1 μm, scan rate of ~3 Hz and resolution of 512 × 512 pixels. DNA contour lengths and bend angles from the obtained AFM images were measured using ImageJ. The bend angle data were binned into histograms and fitted to a Gaussian distribution using MATLAB.

The contact angle was determined using the sitting drop method with a DSA10 Kruss goniometer. Between 7 and 10 drops (0.25–0.35 μL) were applied to each of the peptide films.
SEM studies were performed using a Bruker MultiMode V microscope in Tapping Mode, using antimony doped silicon cantilevers with a spring constant of 40 N/m and a nominal tip diameter of 8 nm.