Transfections were achieved using LipoMAX (SUDGEN, 32011) according to the manufacturer’s protocol. Cells were transfected with 3 μL LipoMAX and 3 μg plasmids encoding Galectin-3-mcherry (#85662), LC3-GFP (#11546), and LC3-GFP-mcherry (#123235) from Addgene in 500 μL serum-free medium. After 72 h incubation, the transfection mixture was removed and replaced with fresh complete medium. For RNA interference by lentiviral vectors, cathepsin D (CTSD) short hairpin RNA (shRNA), cathepsin B (CTSB) shRNA constructs, and a negative control construct created in the same vector system (pLKO.1) were purchased from Corues Biotechnology. Before transfection, 293 T cells were plated in 12-well dishes. Cells were co-transfected with shRNA constructs (10 μg) together with Lentiviral Mix (10 μL) and HG TransgeneTM Reagent (60 μL) according to the manufacturer’s instructions of Lentiviral Packaging Kit (YEASEN, 41102ES20) for 2 days, viral stocks were harvested from the culture medium and filtered to remove non-adherent 293 T cells. To select the Jurkat cells that were stably expressing shRNA constructs, cells were incubated in RPMI-1640 medium with 10% FBS and 2 μg/mL of puromycin for 48 h after lentivirus infection. After selecting cells, stably infected pooled clones were harvested for use.
Gfp lc3
Manufactured by Addgene
Sourced in United States
GFP-LC3 is a fluorescent protein fusion construct that enables the visualization of autophagy processes in living cells. It consists of the green fluorescent protein (GFP) fused to the microtubule-associated protein 1 light chain 3 (LC3) protein, which is a key component of the autophagosome membrane. This fusion protein allows for the real-time tracking and quantification of autophagosome formation and maturation.
Automatically generated - may contain errors
Lab products found in correlation
Fetal bovine serum (fbs), by Thermo Fisher Scientific (4 mentions)
Mrfp gfp lc3, by Addgene (3 mentions)
Lipofectamine 2000 transfection reagent, by Thermo Fisher Scientific (3 mentions)
Transfast transfection kits, by Promega (2 mentions)
Monodansylcadaverine mdc, by Merck Group (2 mentions)
N acetylcysteine nac, by Merck Group (2 mentions)
Lc3b rabbit polyclonal antibody, by Cell Signaling Technology (2 mentions)
Actin mouse monoclonal antibody, by Merck Group (2 mentions)
Antioxidant cocktail supplement b27, by Thermo Fisher Scientific (2 mentions)
Jc 1 mitochondrial membrane potential assay kit, by Cayman Chemical (2 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions)
Lamp1 gfp, by Addgene (2 mentions)
Fugene 6, by Promega (2 mentions)
C1 vector, by Addgene (2 mentions)
Mcherry parkin, by Addgene (2 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (2 mentions)
Bafilomycin a1, by Merck Group (2 mentions)
Lipofectamine rnaimax transfection reagent, by Thermo Fisher Scientific (2 mentions)
Pcdh cmv mcs ef1 puro, by System Biosciences (2 mentions)
Lipofectamine 3000 reagent, by Thermo Fisher Scientific (2 mentions)
30 protocols using gfp lc3
1
Galectin-3 and LC3 Visualization by Transfection
2
Analyzing Autophagy and Mitochondrial Function
3
Autophagy Regulation in Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Beclin-1 and LC3B rabbit polyclonal antibodies were from Cell Signaling (Danvers, MA). Actin mouse monoclonal antibody was from Chemicon (Billerica, MA). AY9944 (trans-1,4 bis-(2-dichlorobenzyl-aminomethyl)cyclohexane dihydrochloride) (1 μM as a working solution), N-acetylcysteine (NAC) and monodansylcadaverine (MDC) were from Sigma (St. Louis, MO). Lipoprotein-deficient serum was from Cocalico Biologicals, Inc. (Reamstown, PA). LC3-GFP was from Addgene and transfast transfection kits were from Promega. Lipofectamine 2000 and the antioxidant cocktail supplement B27 (50 × stock solution) were from Invitrogen (Grand Island, NY. JC-1 Mitochondrial Membrane Potential Assay Kit was from Cayman Chemical Company (Ann Arbor, MI).
4
Assessing Mitochondrial DNA Damage
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In the corresponding experiments, transient transfection was achieved using Lipofectamine 3000 following manufacturer instructions. Plasmids from other sources independent of us but used in this work for transient transfection were: LC3-GFP (Addgene #21073), LAMP1-GFP (Addgene #34831), LC3-GFP-mCherry (kindly provided by Dr. Terje Johansen), Fis1p-GFP-mCherry and MAPL-GFP from CECAD Imaging Facility.
To assess mtDNA damage, cells were treated with 200 μM H2O2, 30 μM CCCP for 4 h or 72 h with media containing 50 ng/ml EtBr and 50 μg/ml Uridine. Different steps of autophagy were blocked using 5 mM 3MA, 20 μM SBI0206965, or 10 μM Chloroquine for 24 h.
To assess mtDNA damage, cells were treated with 200 μM H2O2, 30 μM CCCP for 4 h or 72 h with media containing 50 ng/ml EtBr and 50 μg/ml Uridine. Different steps of autophagy were blocked using 5 mM 3MA, 20 μM SBI0206965, or 10 μM Chloroquine for 24 h.
5
Visualizing Autophagy and Mitophagy Flux
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
GFP-LC3 is a specific marker for the occurrence of autophagosomes formation88 (link),89 (link). GFP-LC3 is the fusion of the green fluorescent protein (GFP) and LC3 and can behave similarly as endogenous LC390 (link),91 (link). The GFP-LC3 is localized on the autophagosome membrane, and green punctate signals are observed91 (link). To confirm TMZ-induced autophagy and autophagy flux inhibition through Baf-A1 (100 nM), cells were transfected with a green fluorescent protein plasmid called LC3-GFP (Addgene, #24920), a vector to visualize autophagosome formation in real time. C2C12s were transfected using JetPrime Polyplus reagent, while RH30 cell line was transfected using Qiagen’s Effectene reagent, as per manufacturer’s instructions. After 48 h of transfection, cells were treated with TMZ (60 h) and Baf-A1 (3 h before imaging). LysoTracker red staining (Molecular Probes™; LysoTracker® Red DND-99; L7528) was used to detect lysosomal activity and MitoTracker Red CMXRos at a concentration of 50 nM to detect active mitochondrial membrane potential. Cells were stained for 30 min in 37 °C incubator. Using this approach, instances, where LC3-GFP puncta co-localized with LysotTracker, were considered to be autophagic, while LC3-GFP co-localization with MitoTracker was interpreted as mitophagy21 .
6
Generating 3T3-L1 Cells with GFP-LC3 or mRFP-GFP-LC3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmids encoding green fluorescent protein (GFP) fused to LC3 (GFP‐LC3) or LC3 tandemly tagged with GFP and red fluorescent protein (RFP) (mRFP‐GFP‐LC3) were obtained from Addgene, Watertown, MA, USA (#21073 or #21074). 3T3‐L1 cells overexpressing GFP‐LC3 or mRFP‐GFP‐LC3 were generated by a retrovirus system using pMXs‐AMNN‐puro‐GFP‐LC3 or pMXs‐AMNN‐puro‐mRFP‐GFP‐LC3 plasmids, as previously reported [20 ]. Briefly, the vectors were transfected into Plat‐E cells using FuGENE®6 (Promega, Madison, WI, USA) following the manufacturer's protocol. Virus‐containing culture supernatants were collected 2 days after transfection and filtered through 0.22 μm filters (Millipore). 3T3‐L1 cells were incubated with virus‐containing medium for 1 day and then selected with 2 μg·mL−1 puromycin for 4 days.
7
Parkin Overexpression and Autophagy Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HA-Parkin and GFP-LC3 were obtained from Addgene (Cambridge, MA, USA) (Plasmid 38248 and 21073). Full-length Parkin cDNA was subcloned into C1 vector (Addgene plasmid 54607) to generate GFP-tagged Parkin construct. Scrambled siRNA (ON-TARGETplus Non-targeting Pool, D-001810-10-05; Dharmacon, Lafayette, CO, USA), FIP200 siRNA (SI02664578; Qiagen, Venlo, Netherlands) and PRKAA1 siRNA (SIHK1776; Sigma, St. Louis, MO, USA) were used in our study. siRNAs were transfected into HeLa cells using Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher Scientific, Waltham, MA, USA). Seventy-two hours post-transfection, cells were treated as indicated.
8
Plasmid Transfection and Mutagenesis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
EGFP-paxillin (plasmid #15233), FLAG-paxillin (plasmid #15212), GFP-LC3 (plasmid #22405), mCherry-LC3 (plasmid #40827), GFP-Rab7 (plasmid #12605), GFP-Rab7-T22N (plasmid #12662) were obtained from Addgene. FLAG-paxillin-Y118F was further modified by GeneScript Inc. Primers used for mutation of the EGFP-paxillin and HA-Cbl (kindly provided by Dr. Youcef Yarden, Department of Biological Regulation, The Weizmann Institute of Science, Rehovot, Israel) using site-directed mutagenesis kit (Stratagene): EGFP-paxillin-Y31F: sense, 5′-CAGAGGAAACGCCTTT CTCCTACCAACTGG-3′; antisense, 5′-CCAGTT GGGTA GGAGAAAGGCGTTTCCTCTG-3′, EGFP-paxillin-Y118F: sense, 5′- GAGGAGGAA CACCTGTTCAGCTT CCCAAACAG-3′; antisense, 5′-CTTGTTTGGGAAGCT GAACACGTGTTCCTCCTC-3′ and HA-Cbl-C381A: sense, 5′-GATGGGCTCCACATTCCAACTAGCTAA AA TATGTGCTGAAAATGATA -3′; antisense, 5′-TATCA TTTTCAGCACATATTTTAGCTAGT TGGAATGTGG AGCCCATC-3′. All plasmids were transfected into BT-20 cells using Lipofectamine LTX and PLUS reagents (Invitrogen) according to the manufacturer′s instructions.
9
Autophagy Monitoring with mCherry-EGFP-LC3 and GFP-LC3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following Addgene plasmids were used: Addgene plasmid 22,418 (mCherry-EGFP-LC3B) and Addgene plasmid 22,405 (GFP-LC3). Flag-Beclin1 was constructed by cloning Beclin 1 into pcDNA3 vector. Site-directed mutagenesis of flag-Beclin 1 was performed using QuikChange XL (Stratagene). Plasmid transient transfection was performed using Lipofectamine 2,000 according to manufacturer’s instructions.
10
Lentiviral Knockdown and Overexpression of Autophagy Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The control firefly luciferase shRNA (shLuc) and two LPIN1‐specific shRNAs (shLPIN1#1 and shLPIN1#2) were a kind gift from Dr. Guangwei Du 5 . The target sequences for shLuc, shLPIN1#1, and shLPIN1#2 are GATTTCGAGTCGTCTTAAT, GTGGTTGACATAGAAATCA, and GCAGAACTCTTCCTAATGA, respectively. The oligos of shRNA targeting IRE1α were synthesized in Genewiz (Suzhou, China) and cloned in pLKO.1 lentiviral vector. The target sequence is GCCCGGCCTCGGGATTTTT. The original GFP‐LC3 (#22405) and mRFP‐GFP‐LC3 (#22418) expression plasmids were ordered from Addgene 9 . For lentivirus‐mediated expression, the cDNA fragment of GFP‐LC3 or mRFP‐GFP‐LC3 was cloned into pCDH‐CMV‐MCS‐EF1‐puro plasmid.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!