Primers for inverse PCR were designed using the Primer3 web interface version 0.4.0 [34] (link) with standard parameters except: Max Repeat Mispriming = 25, Pair Max Repeat Mispriming = 50, Max Template Mispriming = 25, Pair Max Template Mispriming = 50. Mispriming was then investigated by virtual PCR using the Biopieces function ‘pcr_seq’. All contigs >200 nt from assembly of Illumina and 454 reads were loaded twice to mimic circularity and used as mispriming database. Following criteria was used: 1 mismatch allowed, 1 deletion allowed, 1 insertion allowed. All primers used passed this mispriming test. Primers were obtained from TAGC (Copenhagen, Denmark). PCRs were run with Phusion hot-start polymerase (Thermo-Fischer Scientific, Waltham, Massachusetts), according to protocol. Annealing temperatures varied between 56 and 61.5°C depending on Tm calculated by the Primer3 web interface [34] (link) (see Table S1 for list of primers used). Four minutes elongation and 35 cycles were used in all cases. All PCRs were run at least twice. 3% DMSO was used if no product materialized without it. As template, a 100 fold dilution of the original MDA sample was used corresponding to 1,46ng DNA per reaction. PCR products were visualized on 1% agarose gels with ethidium bromide post staining.
Phusion hot start polymerase
Manufactured by Thermo Fisher Scientific
Sourced in France
Phusion Hot Start Polymerase is a high-fidelity DNA polymerase designed for PCR amplification. It exhibits enhanced specificity and sensitivity compared to standard Taq DNA polymerase. The enzyme is inactive at lower temperatures, allowing for room temperature reaction setup.
Automatically generated - may contain errors
Lab products found in correlation
T4 polynucleotide kinase, by New England Biolabs (3 mentions)
Shrimp alkaline phosphatase, by New England Biolabs (2 mentions)
Fast link ligase, by Illumina (2 mentions)
E coli transformax ec100d competent cells, by Illumina (2 mentions)
Recombinant shrimp alkaline phosphatase, by New England Biolabs (1 mentions)
Fast link ligation kit, by Illumina (1 mentions)
Improm 2 reverse transcription system, by Promega (1 mentions)
Tri reagent, by Euromedex (1 mentions)
Pjet1.2 blunt plasmid, by Thermo Fisher Scientific (1 mentions)
Miniprep kit, by Qiagen (1 mentions)
Minelute kit, by Qiagen (1 mentions)
Pdonr207 entry vector, by Thermo Fisher Scientific (1 mentions)
Mgcl2, by Thermo Fisher Scientific (1 mentions)
Phusion hf buffer, by Thermo Fisher Scientific (1 mentions)
Evagreen, by Biotium (1 mentions)
Wizard genomic dna purification kit, by Promega (1 mentions)
Ultra pure pcr water, by Quality Biological (1 mentions)
9 protocols using phusion hot start polymerase
1
Inverse PCR Primer Design and Validation
2
Overexpression Vector Construction for arpR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The full‐length arpR gene including 146 bp of sequence upstream from the GTG start codon and 71 bp downstream from the stop codon were amplified from AB5075 genomic DNA by PCR (Phusion Hot‐Start Polymerase, Thermo Scientific). Primers arpR Exp.1 (5′‐CATTTAAATCGCTTATAACAC‐3′) and arpR Exp.2 (5′‐TTATCGCTCTTATTCAAACT‐3′) were phosphorylated prior to PCR amplification to add 5′ phosphates with T4 polynucleotide kinase (New England Biolabs). The arpR fragment was gel purified and ligated (Fast‐Link Ligation Kit, Epicentre Biotechnologies) into pWH1266 that had been digested with ScaI and treated with recombinant shrimp alkaline phosphatase (rSAP, New England Biolabs). The ligation was electroporated into competent E. coli EC100D Transformax cells (Epicentre Biotechnologies). Plasmids that conferred tetracycline resistance but not ampicillin resistance were purified and confirmed by DNA sequencing prior to introduction into A. baumannii. This produced the expression vector parpR.
3
Cloning and Sequencing of Gal-Nab1 and Gal-Nab2 Antibodies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from hybridoma cell pellets using a Trizol solution (Tri Reagent, Euromedex). It was then reverse-transcribed using the ImProm-II™ Reverse Transcription System from Promega. cDNA segments encoding the variable regions of the heavy and light chains of Gal-Nab1 and 2 were amplified using the Phusion “hot start” polymerase (Thermo Fisher Scientific) and flanking degenerated primers recommended by Srebe et al. [34 ]. Fragments amplified by efficient primers were excised from agarose gels and subjected to a second round of amplification using the same primers. The resulting fragments were ligated in the pJet1.2/blunt plasmid (Thermo Fisher Scientific), cloned in E. coli and subjected to Sanger sequencing. Hypervariable regions (CDR 1, 2 and 3 of heavy and light chains) were identified using the softwares provided by http://www.bioinf.org.uk/abs/ .
4
Plasmid extraction and scFv gene amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pSCEM2 plasmid carrying the scFv gene was extracted from 1 ml of overnight cultures of S. carnosus using a Miniprep kit (Qiagen) and following the manufacturer's instructions but with one important remark: P2 buffer lysis was carried out for 5 min. A region of the scFv (643 bases in length), covering all the CDRs, was PCR amplified with primers including adapters for Illumina sequencing using a Phusion Hot-Start polymerase (Thermo Fisher Scientific) in 50 μl reactions and the following PCR protocol: initial denaturation 98°C 30 s, 15 cycles of denaturation 98°C 8 s, annealing 61°C 25 s, extension 72°C 30 s and final extension 72°C 7 min; 17 ng of template plasmid was used. PCR products were gel purified and extracted using a MinElute kit (Qiagen). See supplementary information for primer and template sequences.
5
Cloning and Verification of Region D Plasmid
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Region D was amplified from AB5075 chromosomal DNA with Phusion Hot Start Polymerase (Thermo Fisher Scientific) using the copB complement dw and copD complement dw primers described in Table 2 . The fragment was cloned into pAJ100 using the added BamHI restriction enzyme sites. The resulting pAJ100-Region D plasmid was electroporated into E. coli Top 10 cells, which were plated on 250 μg/mL hygromycin, 40 μg/mL X-gal, and 1 mM IPTG. A white colony was restreaked for isolation, and a single colony was used to inoculate an overnight culture of LB medium with 250 μg/mL hygromycin. Plasmid was purified and then electroporated into AB4857 and AB5711, which had been made electrocompetent using the protocol described by Jacobs et al. (2014b) (link). Transformants were selected for on LB with 250 μg/mL hygromycin. Double purified single, opaque colonies were used to inoculate overnight cultures of LB medium with 250 μg/mL hygromycin, which were then used to create freezer stocks of the strains. Correct plasmid construction was confirmed by digestion and PCR.
6
Cloning ABUW_1645 Gene in pWH1266 Vector
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To generate an expression plasmid for the ABUW_1645 open reading frame, a 697-bp DNA fragment, which began 60 bp upstream from the predicted ABUW_1645 start codon and ended 82 bp downstream from the predicted ABUW_1645 stop codon, was amplified by PCR using chromosomal DNA from A. baumannii strain AB5075 as the template (Phusion Hot Start Polymerase; Thermo Scientific, Waltham, MA). Oligonucleotide primers (1645 Exp. 1.1; 5′-GAGTGACGGCATGTCTATCT-3′ and 1645 Exp. 2.2; 5′-CTTATAGCCATAAGTGGTAATTGAG-3′) were treated with T4 Polynucleotide Kinase (New England Biolabs, Ipswich, MA) to add 5′-phosphates prior to PCR amplification. The fragment was purified from an agarose gel slice and ligated (Fast-Link Ligase; Epicentre, Madison, WI) into pWH126636 (link) that had been digested with ScaI (New England Biolabs) and subsequently treated with shrimp alkaline phosphatase (New England Biolabs) to dephosphorylate linearized vector. The ligation was transformed into E. coli Transformax EC100D competent cells (Epicentre) and plated on LB+Tet (10 μg/mL) plates, resulting in the expression vector pKT1645.
7
Cloning and Optimization of DGAT1 and DGAT2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The A. thaliana DGAT1 (At2g19450) and DGAT2 (At3g51520) cDNAs (Fig. S1 ) were amplified with proofreading Pfu Ultra DNA polymerase (STRATAGENE, La Jolla, CA, USA) from a mixture of seed cDNAs (of the Ws ecotype) using the primers: 5′-attB1-ATGGCGATTTTGGATTC-3′ and 5′-attB2-TCATGACATCGATCCTTTTC-3′ (DGAT1); 5′-attB1-ATGGGTGGTTCCAGAG-3′ and 5′-attB2-TCAAAGAATTTTCAGCTCAAG-3′ (DGAT2). AttB1 and attB2 refer to the corresponding Gateway recombination sequences. BP recombination was used to introduce the PCR products into the pDONR207 entry vector (INVITROGEN, Carlsbad, CA, USA) for sequencing. Codon sequences were optimized for expression in S. cerevisiae (Fig. S1 ) by Eurofin MWG Operon (Ebersberg, Germany). These sequences were amplified using Phusion Hot Start polymerase (Thermo Scientific, Illkirch, France) and introduced into the BamHI/SmaI restriction sites of the pRT21 vector (also known as pNBT29) [36] (link) to generate proteins fused with a C-terminal GFP. Corresponding constructs were made with a stop codon introduced for expression of DGAT alone without the GFP fusion. Details of the oligonucleotides used are shown in Table 1
8
Cloning ABUW_1645 Gene in pWH1266 Vector
9
16S Ribosomal RNA Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bacterial genomic DNA (gDNA) was isolated from an overnight culture of bacteria using the Wizard Genomic DNA Purification Kit (Promega Corporation, Madison, WI). The stock DNA concentration was determined by the biospectrometer absorbance readings. Next, the desired DNA concentration was achieved through serial dilutions and added to the master mix, which contained the following concentrations: 1× Phusion HF Buffer containing 1.5 mM MgCl 2 (Thermo Fisher Scientific), 0.15 µM forward primer 5′-GyGGCGNACGGGTGAGTAA-3′ (Integrated DNA Technologies), 0.15 µM reverse primer 5′-AGCTGAC GACANCCATGCA-3′ (Integrated DNA Technologies), 0.2 mM deoxynucleotides (dNTPs; Invitrogen, Carlsbad, CA), 2.5× EvaGreen (Biotium), 2× ROX (Bio-Rad Laboratories), 0.02 U/µL Phusion HotStart Polymerase (Thermo Fisher Scientific), 0.3 µM temperature calibrator sequence with 0% GC content (see above), and Ultra Pure PCR water (Quality Biological Inc.) to bring the total volume to 15 µL. A reaction volume of 14.5 µL was spread onto the dPCR chip (see above). A flatbed thermocycler was used to amplify the hypervariable regions, V1 to V6, of the 16S ribosomal RNA (rRNA) gene using the following PCR cycle: 1 cycle of 98 °C for 60 s, and 70 cycles of 95 °C for 15 s, 58 °C for 30 s, and 72 °C for 60 s.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!