Abi 3500 genetic analyser
The ABI 3500 Genetic Analyser is a capillary electrophoresis-based instrument designed for DNA sequencing and fragment analysis. It features 8 capillaries, automated sample handling, and software for data collection and analysis.
Lab products found in correlation
42 protocols using abi 3500 genetic analyser
Validating Disease-Causing Variants via Sanger Sequencing
Multiplex Y-STR Profiling Procedure
HRSV G Gene Sequencing Protocol
Sanger Sequencing of PRRT2 Mutations
HNF1B Gene Mutation Analysis Protocol
Primers for the analysis of rs7405776 were designed (rs7405776_Forward: agccacagactctagatctgg, rs7405776_Reverse: caaagtgctgggattataagtgtg), and the amplicons were sequenced by Sanger sequencing on the ABI3500 Genetic Analyser (Thermo Fisher Scientific, Inc.).
Mutations which are not found in the literature, the Single Nucleotide Polymorphism Database (dbSNP,
TERT Promoter Mutation Detection
FMR1 Repeat Analysis for Genetic Disorders
Isolation of Phacidium lacerum from Eucalyptus
Detecting CDC73 Deletions via MLPA
Cloning and Sequencing of MHC Amplicons
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!