After serum starvation for 24 h, HUVEC medium was supplemented with 2.5% CSE for 24 h as described previously [6 (link)]. To investigate the role of RESV in CSE induced apoptosis, after serum starvation, HUVECs were pretreated with 40 μM RESV (R5010, Sigma-Aldrich Co., St Louis, MO, USA) for 2 h, followed by cotreatment with 2.5% CSE for 24 h. To examine the effects of autophagy on HUVEC apoptosis, the cells were cultured for 2 h in the presence or absence of the potential 5 mM of the autophagy inhibitor 3-methyladenine (3-MA) (A8353, APExBIO, Houston, TX, USA) or 50 nM of the autophagy inducer rapamycin (Rapa) (A8167, APExBIO, Houston, TX, USA) prior to CSE intervention. For Notch1 inhibition, HUVECs were treated with γ-secretase inhibitor DAPT (D5942, Sigma-Aldrich Co., St Louis, MO, USA) for 24 h.
A8167
Manufactured by Apexbio
Sourced in United States
The A8167 is a lab equipment product. It serves as a core function for laboratory operations. The product details and intended use are not available for an unbiased and factual description.
Automatically generated - may contain errors
Lab products found in correlation
6 protocols using a8167
1
HUVEC Apoptosis Regulation by Resveratrol and Autophagy
2
Western Blotting for Autophagy and Cell Cycle Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For Western blotting, the antibodies were anti-GAPDH (1 : 1000; Bioss, bsm-0978 M), anti-LC3 (1 : 1000; Abcam, ab192890), anti-P62 (1 : 1000; Abcam, ab109012), anti-mTOR (1 : 1000; Abcam, ab134903), anti-CDK1 (1 : 1000; Beyotime, AF1516), anti-CDK2 (1 : 1000; Beyotime, AF1063), and anti-Caspase-3 (1 : 1000; CST, 9662). The drug concentrations were 30 μmol/L for rapamycin (Apexbio, A8167), 30 μmol/L for 3-methyladenine (3-MA, Apexbio, A8353), 40 μmol/L for MG-132 (Apexbio, A2585), and 40 μmol/L for MHY1485 (Apexbio, B5853). The Cytoplasmic and Nuclear RNA Purification Kit was purchased from Norge (21000-50 preps). The primers for Q-PCR were as follows: GAPDH: F: GGAGTCCACTGGCGTCTTCA, R: GTCATGAGTCCTTCCACGATACC; U6: F: TGCTTCGGCAGCACATATAC, R: TCACGAATTTGCGTGTCATC; LINC01278: F: TTGCTCCCAGCATTCCACAA, R: TAATCCTCTTCCAGATGGGG; AP003352.1: F: ATGCGATACCAAGTGACTGACA, R: TATTTGCTGGTTGCCCCTTCA; LINC01637: F: TCCGTGTCCTCCAGACCTTT, R: TGTGTGCATCTCTGCGTTGT; AC036214.2: F: AGCAGCGGGAGATGACTCTA, R: TCTGCACCTACACTGGGTGA; AC090617.5: F: TTGCTTAGCTCCCTGGCAAC, R: CTCCAGTTGTGAGTCCTCGG; UBXN10-AS1: F: GTTGCATAGGTCCCTCGGTT, R: TCCCTTCTGAGACGAGCAGA; SOX1-OT: F: ACCAGAGCCGAGGACTAAAC, R: TTGTTGGTTGCACTACCCCTT.
3
Inhibition of Akt and mTOR in N2a Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Perifosine (A8309, APExBIO, USA, 10 μM, dissolved in PBS) and rapamycin (A8167, APExBIO, USA, 50 nM, dissolved in PBS) were used to inhibit Akt and mTOR, respectively. In the corresponding treatment group, each drug was added to the growth medium of N2a cells at the onset of reoxygenation.
4
Hemorrhagic Shock Model in Rats
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Rats received iso urane anesthesia before femoral surgery. Both femoral arteries and the right femoral vein were aseptically cannulated with polyethylene tubing. The tubing was led out from the middle of scapula through a subcutaneous tunnel on the back, and was closed with heparin sodium after xation. The right femoral artery was connected to the PowerLab biological signal acquisition system to monitor MAP, and the contralateral femoral artery was connected to a withdrawal-infusion pump for blood withdrawal. After the surgery and 20-min stabilization period, acute bleeding was carried out rapidly through the left femoral artery at a rate of 0.6 ml/min, and the MAP reached 40 mmHg within 10 minutes and was maintained at 40 ± 2 mmHg for 1 hour. Subsequently, uid resuscitation was performed with the shed whole blood and equal Ringer's solution within 30 minutes. At the same time, the administrations of 3-MA (1.92 mL/100 g, M9281, Sigma-Aldrich, USA), RAPA (4 mL/kg, A8167, Apexbio, Texas, USA) and PHSML were performed, respectively. The sham rats underwent the same operation, but neither hemorrhage nor uid resuscitation.
5
HUVEC Apoptosis Modulation Pathways
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After serum starvation for 24 h, HUVEC medium was supplemented with 2.5% CSE for 24 h as described previously [6] . To investigate the role of RESV in CSE induced apoptosis, after serum starvation, HUVECs were pretreated with 40 μM RESV (R5010, Sigma-Aldrich Co., St Louis, MO, USA) for 2 h, followed by cotreatment with 2.5% CSE for 24 h. To examine the effects of autophagy on HUVEC apoptosis, the cells were cultured for 2 h in the presence or absence of the potential 5 mM of the autophagy inhibitor 3methyladenine (3-MA) (A8353, APExBIO, Houston, TX, USA) or 50 nM of the autophagy inducer rapamycin (Rapa) (A8167, APExBIO, Houston, TX, USA) prior to CSE intervention. For Notch1 inhibition, HUVECs were treated with γ-secretase inhibitor DAPT (D5942, Sigma-Aldrich Co., St Louis, MO, USA) for 24 h.
6
HUVEC Apoptosis Modulation Pathways
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After serum starvation for 24 h, HUVEC medium was supplemented with 2.5% CSE for 24 h as described previously [6] . To investigate the role of RESV in CSE induced apoptosis, after serum starvation, HUVECs were pretreated with 40 μM RESV (R5010, Sigma-Aldrich Co., St Louis, MO, USA) for 2 h, followed by cotreatment with 2.5% CSE for 24 h. To examine the effects of autophagy on HUVEC apoptosis, the cells were cultured for 2 h in the presence or absence of the potential 5 mM of the autophagy inhibitor 3methyladenine (3-MA) (A8353, APExBIO, Houston, TX, USA) or 50 nM of the autophagy inducer rapamycin (Rapa) (A8167, APExBIO, Houston, TX, USA) prior to CSE intervention. For Notch1 inhibition, HUVECs were treated with γ-secretase inhibitor DAPT (D5942, Sigma-Aldrich Co., St Louis, MO, USA) for 24 h.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!