RNA was isolated from osteogenically stimulated cells after 7 and 21 days of culture with the RNeasy Mini Kit Plus (Qiagen, Hilden, Germany), which was applied according to the manufacturer’s protocol. Unstimulated cells served as controls. The concentration and purity of RNA was measured spectrophotometrically (NanoDrop™ Thermo Fisher). RNA was reversely transcribed to cDNA using a cDNA Synthesis Kit and Oligo (dT) primers according to the manufacturer’s protocol (Qiagen). Quantitative PCR (qPCR) was performed using SybrGreen, the DNA kit (Qiagen), and the iQ™ Cycler (Bio-Rad, München, Germany). All samples were analyzed as duplicates and had to show a clear melting curve including a characteristic peak. The target genes were normalized to the reference gene GAPDH using the der ΔΔ t method with ΔCt = Ct test gene − Ct reference gene (GAPDH) and ΔΔCt = ΔCt sample − ΔCt calibrator (unstimulated cells). The relative quantification (RQ) is the -fold change compared to the calibrator and was calculated as 2-ΔΔCt. A RQ of 10 means that this gene is 10 times more expressed in sample x than in the calibrator sample. We considered a RQ significant when there was a minimum of twofold change.
Iq cycler
Manufactured by Bio-Rad
Sourced in United States
The IQ cycler is a real-time PCR instrument designed for quantitative gene expression analysis. It utilizes thermal cycling technology to amplify and detect target DNA sequences in a sample. The instrument features a compact design and supports a range of sample formats.
Automatically generated - may contain errors
Lab products found in correlation
Rnaspin mini kit, by GE Healthcare (4 mentions)
Iscript cdna synthesis kit, by Bio-Rad (4 mentions)
Rneasy kit, by Qiagen (4 mentions)
Universal probe library, by Roche (3 mentions)
Faststart universal probe master, by Roche (3 mentions)
Sybr green supermix, by Bio-Rad (3 mentions)
Sybr green mix, by Thermo Fisher Scientific (2 mentions)
Sybr green supermix, by Thermo Fisher Scientific (2 mentions)
Mml 5 polymerase, by Thermo Fisher Scientific (2 mentions)
Dnase, by Promega (2 mentions)
Rnase free dnase set, by Qiagen (2 mentions)
Sybr green, by Qiagen (1 mentions)
Nanodrop, by Thermo Fisher Scientific (1 mentions)
Cdna synthesis kit, by Qiagen (1 mentions)
Oligo dt primer, by Qiagen (1 mentions)
Rneasy plus mini kit, by Qiagen (1 mentions)
Iscript kit, by Bio-Rad (1 mentions)
Trizol ls, by Thermo Fisher Scientific (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Rna later solution, by BioGenex (1 mentions)
24 protocols using iq cycler
1
RNA Extraction and qPCR Analysis
2
Real-Time PCR Quantification of Immune Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A total of 2 μL of the cDNA template was added into 18 μL of the FastStart Universal Probe Master (Roche Diagnostics), with 500 nM each of forward and reverse primers and 100 nM locked nucleic acid (LNA) probe (Universal ProbeLibrary; Roche Diagnostics). The PCR systems for the reference genes β-actin and cyclophilin A, as well as for the genes of interest, TLR2, TLR4, TLR9, MyD88, and TRIF, were listed elsewhere [29 (link)]. The PCR amplification was performed in duplicates in 45 cycles (95 °C for 15 s and 60 °C for 60 s) and run on an iQ cycler (Bio-Rad, Hercules, CA, USA). The evaluation of relative mRNA expression (fold changes) was described elsewhere [46 (link)].
3
Quantitative miRNA Mimics Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For miRNA mimic experiments, RNA was extracted from N2A cells 24 h post transfection with Trizol (Ambion). RNA was further purified with DNAse treatment on High Pure RNA Isolation columns (Roche). Total RNA (0.5 μg) was reverse transcribed with the iScript kit (Biorad). qPCR was done with SYBR Green Mix (Life Technologies) on the iQ Cycler (Biorad). Gene-specific primers (Supplementary Table 7 ) were designed with Primer3 and tested to confirm efficient amplification of single products59 (link). The following programme was carried to 40 cycles: 30 s 95 °C (denaturation); 30 s 58 °C (annealing); and 20 s 72 °C (extension). Results were analysed by ΔΔCt, using RPL10A mRNA, an abundant transcript with negligible AGO binding in its 3′-UTR in brain, for normalization.
For E. coli/mouse mixing experiments inSupplementary Fig. 2 , RNA was extracted with Trizol LS (Ambion). Equal volumes re-suspended RNA were reverse transcribed with the iScript kit and analysed by qPCR as above.
For E. coli/mouse mixing experiments in
4
Quantifying mRNA Transcripts in Duodenal Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Duodenal samples from human patients were obtained in RNA Later Solution (Biogenex) and stored until extraction at −80°C. Total RNA was isolated with RNA Spin Mini kit (GE Healthcare). Reverse transcription was performed using 1μg of the total RNA using MML-V polymerase and random primers from Molecular Probes Inc., (Invitrogen, Carlsbad, CA, USA) were used. The Real-time PCR (qPCR) was performed using an IQ-Cycler (Bio-Rad) with the SYBR Green Supermix (Invitrogen, cat 11761-100, USA). EEF1A1 transcript was used as housekeeping gene. The threshold cycle was used as indicative of relative expression level, as described by Ginzinger (28 (link)). Primer sequences used are listed in Table 1
5
Quantitative RT-PCR of Chemokines and Cytokines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was isolated from whole biopsy samples using an RNA Spin Mini kit (GE Healthcare, cat 25-0500-72). The RNA quality and quantity were assessed through conventional spectrophotometric methods. Reverse transcription was performed using 1 µg of the total RNA. MML-V polymerase and random primers were obtained from Molecular Probes Inc., Invitrogen (Carlsbad, CA, USA). Real-time PCR was performed using an IQ-Cycler (Bio-Rad) with the SYBR Green Supermix (Invitrogen, cat 11761-100). β-actin was used as the housekeeping gene. Relative quantitation of gene expression was calculated using the accurate Ct (threshold cycle) method [18] (link). Table 1 shows the primer pairs used in this work. The running protocol for the detection of CXCL9, CXCL10, CXCL11, and CXCR3 was the following: 95°C for 10 min and 50 cycles of 60°C for 15 s, 72°C for 45 s, and 95°C for 15 s. For IFNγ, TNFα, and IFNβ, the protocol was the following: 95°C 10 min and 50 cycles of 62°C for 1 min and 95°C 15 s.
6
Quantitative analysis of SARS-CoV-2 host response
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from SARS-CoV-2 (Wuhan strain) infected Calu-3 cells was isolated with RNA Spin Mini kit (GE Healthcare). Reverse transcription was performed using 1 μg of the total RNA using MML-V polymerase and random primers from Molecular Probes Inc (Invitrogen, Carlsbad, CA, USA) were used. Quantitative real-time PCR was performed using SYBER Green Supermix (Invitrogen, cat 11,761–100, USA) on an IQ-Cycler (Bio-Rad). The specific primers to amplify fragments corresponding to specific gene targets were used: β-actin, forward, 5′-CCT GGC ACC CAG CAC AAT-3′, reverse, 5′-GCC GAT CCA CAC GGA GTA CT-3′; C-X-C motif chemokine ligand 10 (CXCL10), forward, 5′-TCC ACG TGT TCA GAT CAT TGC-3′, reverse, 5 TG A TGG CCT TCG ATT CTG G-3′; CeC Motif Chemokine Ligand 20 (CCL20), forward, 5′-CCA AGA GTT TGC TCC TGG CT-3′, reverse, 5′-TGC TTG CTG CTT CTG ATT CG-3′; Dynamin-like GTPase myxovirus resistance protein 1 (Mx-1), forward, 5′-GCC GGC TGT GGA TAT GCT-3′, reverse, 5′-TTT TTT ATC GAA ACA TCT GTG AAA GC-3′; C-X-C Motif Chemokine Ligand 2 (CXCL2), forward, 5′-AAG GTG AAG TCC CCC GGA C-3′, reverse, 5′-GCC CAT TCT TGA GTG TGG CT-3′. All data are presented as relative expression units after normalization to the β-actin gene. Measurements were conducted in triplicate.
7
Quantification of mRNA Expression in Adipose Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated as previously described (Arsenijevic et al., 1997 (link)). The RNA was then treated with DNase, after which it was reverse transcribed (Promega). Thereafter we ran a RT-PCR (iQ cycler Bio-Rad). Each sample was normalized to its cyclophilin value. For the list of primers used and their sources, see Table 2 . Samples were incubated in the iCycler instrument (BioRad, iCycler iQ, Version 3.1.7050) for an initial denaturation at 95°C for 3 min, followed by 40 cycles of amplification. Each cycle consisted of 95°C for 10 s, 60 or 62°C for 45 s, and finally 95, 55, and 95°C for 1 min each. Green I fluorescence emission was determined after each cycle. The relative amount of each mRNA was quantified by using the iCycler software. Amplification of specific transcripts was confirmed by melting curve profiles generated at the end of each run. Cyclophilin was used as the control for each study and the relative quantification for a given gene was normalized to cyclophilin mRNA values. Note that as representative of subcutaneous white adipose tissue (SWAT) we used inguinal fat (IWAT) for PCR, western blot and other analysis.
8
Quantitative PCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two μL of the PCR template and 18 μL of the FastStart Universal Probe Master (Roche Diagnostics) containing 500 nM each of the forward and reverse primers (Generi-Biotech, Hradec Kralove, Czechia), and 100 nM locked nucleic acid (LNA) probe (Universal ProbeLibrary; Roche Diagnostics) were mixed (Table 1 ). The PCR amplification was performed in duplicates in 45 cycles (95 °C for 15 s and 60 °C for 60 s) ran on an iQ cycler (Bio-Rad, Hercules, CA, USA). Relative mRNA expressions were calculated by the 2−ΔCT method [43 (link)] and normalized to β-actin and cyclophilin A by GenEx 6 software (MultiD Analyses AB, Gothenburg, Sweden) [42 (link)].
9
Quantitative Analysis of Intestinal Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from whole biopsy samples using an RNA Spin Mini kit (GE Healthcare, cat. 25-0500-72). Reverse transcription was performed using 1 µg of total RNA. MML-V polymerase and random primers were obtained from Molecular Probes Inc., Invitrogen (Carlsbad, CA, USA). Quantitative Real Time PCR was performed in an IQ Cycler from BioRad using SYBR green mix (Invitrogen, cat. 11761-100) and specific primers for the genes of interest: IFABP forward AGCACTTGGAAGGTAGACCG, IFABP reverse CCCCTGAGTTCAGTTCCGTC; LFABP forward AGCTCTATTGCCACCATGAGTTTCT, LFABP reverse AACTGAACCACTGTCTTGACTTTCTC; β-actin forward ATGGGTCAGAAGTCCTATGTG, β-actin reverse CTTCATGAGGTAGTCAGTCAGGTC; villin forward CTACACCACACAGATGGATGACTTC, villin reverse GACATCTCTACCTCTCCAGCTACCA. The comparative Ct method was used to quantify IFABP and LFABP transcripts normalizing alternatively with β-actin or villin. Values are expressed as mean ± standard deviation (s.d.) of the mean.
10
Quantitative miRNA Expression Analysis
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!