Log In Sign up
The largest database of trusted experimental protocols

Surveyor nuclease assay

Manufactured by Integrated DNA Technologies
Visit Supplier
Sourced in Belgium

The Surveyor nuclease assay is a tool used to detect and analyze genetic mutations. It employs the Surveyor nuclease enzyme to cleave DNA at sites of sequence variations, allowing for the identification and quantification of genetic differences between samples.

Automatically generated - may contain errors

Lab products found in correlation

Pspcas9 bb 2a puro px459, by Addgene (2 mentions) 2100 bioanalyzer, by Agilent Technologies (1 mentions) Dneasy blood and tissue kit, by Qiagen (1 mentions) Q5 polymerase, by New England Biolabs (1 mentions) In fusion kit, by Takara Bio (1 mentions) Pspcas9 bb 2a gfp, by Addgene (1 mentions)

8 protocols using surveyor nuclease assay

1

CRISPR-Mediated Knockout of Trp53 and Brca2

Check if the same lab product or an alternative is used in the 5 most similar protocols
Two open-access software programs, CHOPCHOP (https://chopchop.rc.fas.harvard.edu/) and CRISPR design (http://crispr.mit.edu/) were used to design guide RNAs (gRNA) targeted to Trp53 exon 5 and Brca2 exon 3. Three guides were designed per gene. Annealed oligonucleotides were ligated into BbsI-linearised pSpCas9(BB)-2A-Puro (PX459 (20 (link)), gifts from Feng Zhang via Addgene). Version 1 (Addgene # 48139) was employed for Trp53 deletion and version 2.0 (Addgene # 62988) for Brca2. All plasmids were sequenced to confirm successful ligation.
4x105 ID8 cells were plated overnight in antibiotic-free medium, and transfected with 4µg PX459 using Lipofectamine 2000, selected under puromycin (2.5 µg/ml) for 48 hours and plated onto 96 well plates (10 cells/ml). Single cell colonies were expanded for DNA extraction, protein extraction and cryopreservation.
PCR primers spanning potential sites of deletion were designed (Trp53: F 5’-cttccctcacattcctttcttg-3’; R 5’-gctgttaaagtagaccctgggc-3’, Brca2: F 5’-catggagggagtcacctttg-3’; R 5’-gctctggctgtctcgaactt-3’). Clones with large PCR deletions were selected for subsequent analysis. Remaining clones were screened using the Surveyor Nuclease Assay (Integrated DNA Technology). Mutations were confirmed by Sanger sequencing. All sequence alignment was performed using MAFFT version 7 (http://mafft.cbrc.jp/)
Walton J., Blagih J., Ennis D., Leung E., Dowson S., Farquharson M., Tookman L.A., Orange C., Athineos D., Mason S., Stevenson D., Blyth K., Strathdee D., Balkwill F.R., Vousden K., Lockley M, & McNeish I.A. (2016). CRISPR/Cas9-mediated Trp53 and Brca2 knockout to generate improved murine models of ovarian high grade serous carcinoma. Cancer research, 76(20), 6118-6129.
+ Open protocol
+ Expand
2

Surveyor Nuclease Assay for Gene Disruption

Check if the same lab product or an alternative is used in the 5 most similar protocols
Surveyor nuclease assay (Integrated DNA Technologies, Leuven, Belgium) was used to determine the frequencies of gene disruption as described previously (Cai et al., 2014a (link)). Briefly, iPSCs or CD34+ cells were incubated with ZFN-loaded LPs for 48 hr and collected for DNA extraction. HEK293T cells transduced by IDLV-ZFN(AAVS1)/egfp or IDLV-ZFN(AAVS1)/fluc were also subjected to Surveyor nuclease assay. CCR5 and AAVS1 fragments were amplified using primer sets YJ224F-YJ225R and YJ222F-YJ223R, respectively. The PCR products were incubated with 1 μl Surveyor nuclease plus 1 μl enhancer at 42°C for 1 hr after denaturation and re-annealing. The cleavage products were separated on a 1.5% agarose gel and stained with ethidium bromide. The percentage of indels was determined by the formula 100 × (1−(1−fraction cleaved)1/2), wherein the fraction cleaved is the sum of the cleavage product peaks divided by the sum of the cleavage product and parent peaks.
Cai Y., Laustsen A., Zhou Y., Sun C., Anderson M.V., Li S., Uldbjerg N., Luo Y., Jakobsen M.R, & Mikkelsen J.G. (2016). Targeted, homology-driven gene insertion in stem cells by ZFN-loaded ‘all-in-one’ lentiviral vectors. eLife, 5, e12213.
+ Open protocol
+ Expand
3

CFTR Gene Editing with TALENs

Check if the same lab product or an alternative is used in the 5 most similar protocols
TALEN expression vectors designed to target and cleave 55–57 bp 3′ of the p.F508del mutation, were synthesized by Transposagen (USA). The length of the recognition sequence of each TALEN is 17 bp (left binding site: 5′-ACAGAAGCGTCATCAAA-3′; right binding site: 5′-AGGTAAGAAACTATGTG-3′) and is separated by a 16-bp spacer. The expression of the TALEN genes is under control of the cytomegalovirus (CMV) promoter.
The cleavage activity of the newly generated CFTR TALENs was analyzed in two highly transfectable cell lines, K562 and HeLa. 1 × 106 K562 and HeLa cells were transiently transfected with 2 μg of each TALEN vector for 48 h. Genomic DNA from the TALEN-transfected cell populations was isolated and the target site amplified by PCR using the ZFN-forward (Fw)/P6 primers (see Table S1). To assess the frequency of indels generated after cleavage by TALENs, the Surveyor nuclease assay (Integrated DNA Technologies [IDT], Belgium) was used. For this purpose, PCR amplicons were denatured and slowly reannealed. Resulting heteroduplexes were cleaved by the Surveyor nuclease, whereas homoduplexes were left intact. The heterogeneous DNA population was run on a microchip device (Bioanalyzer 2100; Agilent, USA), and the efficiency of TALEN cleavage (percentage of indels) was quantified by densitometry as a ratio between cleaved and noncleaved DNA bands.
Fleischer A., Vallejo-Díez S., Martín-Fernández J.M., Sánchez-Gilabert A., Castresana M., del Pozo A., Esquisabel A., Ávila S., Castrillo J.L., Gaínza E., Pedraz J.L., Viñas M, & Bachiller D. (2020). iPSC-Derived Intestinal Organoids from Cystic Fibrosis Patients Acquire CFTR Activity upon TALEN-Mediated Repair of the p.F508del Mutation. Molecular Therapy. Methods & Clinical Development, 17, 858-870.
+ Open protocol
+ Expand
4

CRISPR Protocols for Mouse Models

Check if the same lab product or an alternative is used in the 5 most similar protocols
sgRNAs for the R26mTmG/+ and SftpcI73T mouse models were chosen on the basis of high on-target efficiency and low off-target effects using the online tool at http://crispr.mit.edu (12 (link)). For R26mTmG/+ mouse experiments, sgRNAs were designed to target both the loxP sites flanking the mT-tdTomato and stop cassette, causing the edited cells to express EGFP. For SftpcI73T mouse experiments, sgRNAs were designed to target the 5′ and 3′ ends of the Sftpc gene. The sgRNAs targeting the Sftpc gene were screened by Surveyor assay in vitro. Briefly, the Sftpc sgRNAs were cloned into plasmid pSpyCas9(BB)-2A-GFP (PX458; a gift from F. Zhang; Addgene plasmid no. 48138) (12 (link)), which was used to transfect mouse neuro-2a cells. Genomic DNA was extracted using DNeasy blood and tissue kit (QIAGEN) 48 hours after transfection. Indel efficiency of each sgRNA was assessed by Surveyor nuclease assay (Integrated DNA Technologies) as previously described after amplifying with primers flanking the target site (12 (link)). The protospacer and PAM sequences screened and the PCR primers used in the Surveyor assay are listed in tables S1 and S2, respectively.
Alapati D., Zacharias W.J., Hartman H.A., Rossidis A.C., Stratigis J.D., Ahn N.J., Coons B., Zhou S., Li H., Singh K., Katzen J., Tomer Y., Chadwick A.C., Musunuru K., Beers M.F., Morrisey E.E, & Peranteau W.H. (2019). In utero gene editing for monogenic lung disease. Science translational medicine, 11(488), eaav8375.
+ Open protocol
+ Expand
5

Surveyor Nuclease Assay for CRISPR Guide Efficiency

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
To quantify the efficiency of each guide strand, the Surveyor® nuclease assay (Integrated DNA Technologies, Coralville, IO) was performed as previously described.22 (link) Briefly, an 869-bp PCR product was produced using Q5 polymerase (New England Biolabs) and primers Surveyor-F Surveyor-R (Table S1). The purified PCR products were denatured and re-annealed for heteroduplex formation. Finally, the annealed heteroduplexes were digested with Nuclease S + enhancer and loaded into an agarose gel for visualisation. As an alternative method for assessing guide strand efficiency, PCR products were sent to the AGRF for Sanger Sequencing and analysed using TIDE.23 (link) Additionally, the PCR products from 1 mouse per guide were cloned and individually sequenced to confirm the results obtained by Surveyor® and TIDE analysis.
Ginn S.L., Amaya A.K., Liao S.H., Zhu E., Cunningham S.C., Lee M., Hallwirth C.V., Logan G.J., Tay S.S., Cesare A.J., Pickett H.A., Grompe M., Dilworth K., Lisowski L, & Alexander I.E. (2019). Efficient in vivo editing of OTC-deficient patient-derived primary human hepatocytes. JHEP Reports, 2(1), 100065.
+ Open protocol
+ Expand
6

Deleting Brca1, Pten, and Nf1 with CRISPR/Cas9

Cited 3 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
Guide RNAs targeting the PALB2-binding domain in exon 12 and the BRCT-2 domain in exon 19 of Brca1 were designed using two open-access software programs, CHOPCHOP (https://chopchop.rc.fas.harvard.edu/) and CRISPR design (http://crispr.mit.edu/), and ligated into BbsI-linearized pSpCas9(BB)-2A-Puro [PX45928 (link), a gift from Feng Zhang via Addgene]. The gRNA for Pten was a gift from Douglas Strathdee (CRUK Beatson Institute, Glasgow, UK) and targeted exon 5, encoding the phosphatase domain. The gRNA for Nf1 was designed to target exon 2 as previously described29 (link). gRNAs for Pten and Nf1 were ligated into PX33030 (link) (a gift from Walter Jackson via Addgene, ref 78621).
Cells were transfected as previously14 (link), omitting puromycin selection for Pten and Nf1 targeting. PCR primers spanning target sites of deletion are listed in Table S1. PCR products were cloned using InFusion kit (ClonTech) and clones with large PCR deletions were selected for subsequent analysis. Remaining clones were screened using the Surveyor Nuclease Assay (Integrated DNA Technology). Mutations were confirmed by Sanger sequencing. All sequence alignment was performed using MAFFT version 7 (http://mafft.cbrc.jp/).
Walton J.B., Farquharson M., Mason S., Port J., Kruspig B., Dowson S., Stevenson D., Murphy D., Matzuk M., Kim J., Coffelt S., Blyth K, & McNeish I.A. (2017). CRISPR/Cas9-derived models of ovarian high grade serous carcinoma targeting Brca1, Pten and Nf1, and correlation with platinum sensitivity. Scientific Reports, 7, 16827.
+ Open protocol
+ Expand
7

CRISPR-Mediated Knockout of MLKL in TOV21G Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Two open-access software programs, CHOPCHOP (https://chopchop.rc.fas.harvard.edu/) and CRISPR design (http://crispr.mit.edu/), were used to design guide RNAs (gRNA) targeted to MLKL exon 5. Three guides were designed, although only one guide, which targeted the RIPK3 phosphothreonine target site of MLKL (nt 25408-25437 inclusive), yielded knockout clones. Annealed oligonucleotides were ligated into BbsI-linearised pSpCas9(BB)-2A-Puro (PX459 v2—Addgene no. 6298846 (link), a gift from Feng Zhang via Addgene). All plasmids were sequenced to confirm successful ligation.
TOV21G cells (4 × 105) were plated overnight in antibiotic-free medium and transfected with 4 µg PX459 using Lipofectamine 2000, selected under puromycin (2.5 µg/ml) for 48 h and plated onto 96-well plates (10 cells/ml). Single-cell colonies were expanded for DNA extraction, protein extraction and cryopreservation.
PCR primers spanning potential sites of deletion were designed (Forward 5ʹ-ACAATCCCTGCCCTTTACTCC-3ʹ, Reverse 5ʹ-GAGTTTAGGTGGTCCTTGGAGG-3ʹ). Clones with large PCR insertion/deletions were selected for subsequent analysis. Remaining clones were screened using the Surveyor Nuclease Assay (Integrated DNA Technology). Mutations were confirmed by Sanger sequencing. All sequence alignment was performed using MAFFT version 7 (http://mafft.cbrc.jp/).
Weigert M., Binks A., Dowson S., Leung E.Y., Athineos D., Yu X., Mullin M., Walton J.B., Orange C., Ennis D., Blyth K., Tait S.W, & McNeish I.A. (2017). RIPK3 promotes adenovirus type 5 activity. Cell Death & Disease, 8(12), 3206.
+ Open protocol
+ Expand
8

CRISPR Guide RNA Cloning and Validation

Check if the same lab product or an alternative is used in the 5 most similar protocols
The TET1-CDKO CRISPR site (GACTTCTGTGCTCATCCCCAC) was designed using the online tool at http://crispr.mit.edu/. The corresponding guild RNA sequence was cloned into pSpCas9(BB)-2A-GFP (PX458, Addgene) following the previously published protocol35 (link). Efficacy of this CRISPR site and plasmid were confirmed in 293T cells using Surveyor nuclease assay (Integrated DNA technologies, IDT).
Li H., Hu Z., Jiang H., Pu J., Selli I., Qiu J., Zhang B, & Feng J. (2020). TET1 Deficiency Impairs Morphogen-free Differentiation of Human Embryonic Stem Cells to Neuroectoderm. Scientific Reports, 10, 10343.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!