Iscript cdna synthesis kit

Total and polysomal RNA were reverse transcribed with the iScript cDNA synthesis kit (Quanta Biosciences), and qPCR analysis was carried out using iQ SYBR Green Supermix (Quanta Biosciences) on a BioRad CFXConnect instrument. Oligonucleotides used for detection of specific mRNAs in each fraction from sucrose gradients are as follows: CTGGCTAAAGCTGGTGAAGG and TGGGTCTATTGGCCTTTCTG for FKBP11 mRNA, CCGCTGGTTTAACATTTCGT and TCAGCAACTGCTGGAAAATG for MARS mRNA, CATGGACTCCAGGAGGGTAA and TCACAGGTGACTGGGGTGTA for CDC25A mRNA, TATGACCCCCACCCAGATAG and ACTAAGCGCCAGAAACTGGA for TCL1A mRNA, GGAGGAGCCCATTTACATCA and ATGTATGCCATTCCCTCTGC for LYN mRNA, AGACGGAAGGTGCTGAGAAA and GAAGCATTGGGGATCAAGAA for YWHAZ mRNA and, CGGAGTCAACGGATTTGGTCGTAT and AGCCTTCTCCATGGTGGTGAAGAC for GAPDH mRNA.

T-GFP ES cells were maintained on gelatin-coated plates and differentiated as embyoid bodies (EBs) in serum-free, feeder-free conditions, as previously described [20] (link). Day 2 EBs were dissociated with Trypsin-EDTA and 4×10⁵ cells were cultured in ultra-low attachment 6-well dishes with 100 ng/ml recombinant Wnt3a (R&D Systems) or 1 µM CHIR99021 (ToCris) for 2 days. Total RNA was extracted using the RNeasy miniprep kit (Qiagen) and first stand cDNA synthesized using iScript cDNA synthesis kit (Quanta Biosciences). Relative gene expression was analyzed with iTaq universal SYBR Green (BioRad) using the CFX96 Real-Time PCR Detection system (BioRad). Relative fold changes were calculated by normalizing to Gapdh levels using the 2^−ΔΔCt method. qPCR primers are listed in Table S4.

To confirm the accuracy of the RNA-Seq analysis, quantitative real-time PCR (qRT-PCR) analysis was conducted. Total RNAs were extracted from the gill and air-breathing organ using the RNeasy Plus Universal Mini kit (Qiagen, CA) following the manufacturer’s instructions. After quantification with a Nanodrop spectrophotometer (Thermo Scientific), cDNA was synthesized with a final concentration of 50 ng/μL using the iScript cDNA Synthesis Kit (Quanta BioSciences) based on the manufacturer’s protocol. The primers used in qRT-PCR are listed in Additional file 1: Table S16. Amplification was performed on a CFX96 real-time PCR Detection System (Bio-Rad, CA). The thermal cycling profile consisted of an initial denaturation at 95 °C for 30 s, 40 cycles of denaturation at 94 °C for 5 s and an appropriate annealing/extension temperature at 60 °C for 10 s, and 72 °C for 5 s, followed by dissociation curve analysis to validate the specificity of amplified products. The 28S ribosomal RNA (rRNA) [126 (link)] (accession number JK488212) was used as the reference gene. Relative fold-changes for each gene were calculated in the Relative Expression Software Tool (REST) version 2009 [127 (link)] based on the values of cycle threshold (C_t) from real-time PCR.