DNA-free RNA, prepared as described above, was heat-treated at 80 °C for 5 min. Subsequently, 30 μg of RNA was annealed at 75 °C for 10 min, and then the temperature was allowed to slowly decrease to 60 °C within 30 min. Annealing was performed in a buffer containing 100 mM NaCl and 50 mM Tris-Cl at pH 7.5. The specific primers (Additional file 4 : Table S1) and the φX174 DNA/HinfI dephosphorylated marker were labeled using [γ32-P]ATP (3000 Ci/mmol) (PerkinElmer; Boston, USA) and T4 polynucleotide kinase, according to the manufacturer’s instructions for the Primer Extension System-AMV Reverse Transcriptase (Promega; Madison, USA). Runoff reverse transcription reactions were performed for 1 h at 60 °C using 15 units of ThermoScript™ RNase H- (Invitrogen; California, USA) in its provided buffer (complemented with 1 mM of each dNTP and 5 mM DTT). Reactions were stopped by the addition of one volume of loading dye (Promega; Madison, USA) and were analyzed on 6 % polyacrylamide sequencing gels containing 8 M urea. The results were visualized either using X-ray films or exposure for 24 h to Imaging Plates (IP BAS-MP 2040S), which were analyzed with a Fujifilm-BAS 1500 (Fuji; Tokyo, Japan).
Loading dye
Manufactured by Promega
Sourced in United States
Loading dye is a laboratory reagent used to track the progress of DNA or protein samples during electrophoresis. It is a mixture of small molecules that migrate through an agarose or polyacrylamide gel at a known rate, providing a visual indicator of how far the samples have traveled.
Automatically generated - may contain errors
Lab products found in correlation
γ32 p atp 3000 ci mmol, by PerkinElmer (1 mentions)
Primer extension system amv reverse transcriptase, by Promega (1 mentions)
Geldoc xrs, by Bio-Rad (1 mentions)
Litesizer 500 instrument, by Anton Paar (1 mentions)
Horizontal electrophoresis, by Bio-Rad (1 mentions)
Midori green advance, by Nippon Genetics (1 mentions)
Universal hood 2 gel doc system, by Bio-Rad (1 mentions)
Imagequant las 4000, by GE Healthcare (1 mentions)
C1000 touch thermal cycler, by Bio-Rad (1 mentions)
Pcr buffer, by Qiagen (1 mentions)
Dna ladder, by Promega (1 mentions)
Dnaeasy plant mini kit, by Qiagen (1 mentions)
Ingenius3, by Syngene (1 mentions)
Amplitaq polymerase, by Thermo Fisher Scientific (1 mentions)
Image lab software, by Bio-Rad (1 mentions)
Goscript reverse transcriptase kit, by Promega (1 mentions)
Chemidoc xrs system, by Bio-Rad (1 mentions)
Mastercycler pro s thermocycler, by Eppendorf (1 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (1 mentions)
Agilent dna 1000 kit, by Agilent Technologies (1 mentions)
10 protocols using loading dye
1
RNA Annealing and Reverse Transcription Protocol
2
CRISPR/Cas9 Nanoparticle Formulation and Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRISPR/Cas9
plasmids were purchased from the Addgene repository. (Addgene plasmids
#78535 and 78547).38 (link) Two sgRNAs were selected
to target eGFP sequence (sgRNA1: GAGCTGGACGGCGACGTAAACGG;
sgRNA2: CAGAACACCCCCATCGGCGACGG). The
amino lipid carriers were dissolved in ethanol at a stock concentration
of 2.5 mM, while the plasmids of CRISPR/Cas9 system were reconstituted
in nuclease-free water at 0.5 μg/μL. Nanoparticles are
formulated by mixing the amino lipids with plasmid DNA for 30 min
in nuclease-free water at prespecified N/P ratios. The size and zeta
potential of the nanoparticles were analyzed using an Anton Paar Litesizer
500 instrument (Anton Paar USA Inc., Ashhland, VA) in nuclease free
water.
The encapsulation of CRISPR/cas9 plasmids in the nanoparticles
was assessed by gel electrophoresis. Lipid/plasmid DNA nanoparticles
(4 μL) and 4 μL of loading dye (Promega, Madison, WI)
and 16 μL nuclease free water were mixed. The mixture (20 μL)
was loaded onto a 0.7% agarose gel containing ethidium bromide. The
gel was submerged in 0.5× Tris/Borate/EDTA (TBE) buffer and run
at 100 V for 25 min. Plasmid DNA bands were visualized using GelDoc
XRS (Bio-Rad, Hercules, CA).
plasmids were purchased from the Addgene repository. (Addgene plasmids
#78535 and 78547).38 (link) Two sgRNAs were selected
to target eGFP sequence (sgRNA1: GAGCTGGACGGCGACGTAAACGG;
sgRNA2: CAGAACACCCCCATCGGCGACGG). The
amino lipid carriers were dissolved in ethanol at a stock concentration
of 2.5 mM, while the plasmids of CRISPR/Cas9 system were reconstituted
in nuclease-free water at 0.5 μg/μL. Nanoparticles are
formulated by mixing the amino lipids with plasmid DNA for 30 min
in nuclease-free water at prespecified N/P ratios. The size and zeta
potential of the nanoparticles were analyzed using an Anton Paar Litesizer
500 instrument (Anton Paar USA Inc., Ashhland, VA) in nuclease free
water.
The encapsulation of CRISPR/cas9 plasmids in the nanoparticles
was assessed by gel electrophoresis. Lipid/plasmid DNA nanoparticles
(4 μL) and 4 μL of loading dye (Promega, Madison, WI)
and 16 μL nuclease free water were mixed. The mixture (20 μL)
was loaded onto a 0.7% agarose gel containing ethidium bromide. The
gel was submerged in 0.5× Tris/Borate/EDTA (TBE) buffer and run
at 100 V for 25 min. Plasmid DNA bands were visualized using GelDoc
XRS (Bio-Rad, Hercules, CA).
3
Characterization of G4/ECO/pDNA Nanoparticles
4
Agarose Gel Electrophoresis of Plasmid DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmid products were loaded on the gel by mixing 40 µL of the resuspended pellet with 5 µL of loading dye (Promega, Madison, WI, USA). Then, plasmid products were analyzed by electrophoresis in 0.8% (w/v) agarose stained with 10 µL of 0.5 μg/mL of ethidium bromide in 1× TBE buffer at 100 V and 200 mA for 55 min. A 1 kb DNA ladder (Promega, Madison, WI, USA) was used as a linear DNA marker. Plasmid fragments were then visualized with UV transilluminator. The estimated molecular weight (kb) of the plasmid fragments were measured by comparing their band pattern obtained in agarose gel electrophoresis with the DNA marker.
5
Agarose Gel Electrophoresis of PCR Products
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Horizontal electrophoresis (Bio‐Rad) was used to analyze the PCR products using 2% (w/v) agarose gel with Midori Green Advance (Nippon Genetics), in 0.5× TBE buffer. For each sample, 5 µL of PCR product plus 1 µL of loading dye (Promega) were placed in wells. For electrophoresis, a migration at 100 V for 40 min was performed. The gel was exposed to ultraviolet light, and the picture was taken with a gel documentation system (Chemidoc gel touch; Bio‐Rad).
6
Agarose Gel Electrophoresis for DNA Separation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Agarose gel 1.0% (w/v) was used for determining the presence of DNA and the size of PCR products. The gel was placed in the electrophoresis chamber and added with 1× TAE buffer. Then, 10 µL of each sample for analysis (9 µL added with 1 µL loading dye, Promega) was prepared and loaded into the lane by using a micropipette. All agarose gels in this experiment used DNA 1kb Gene Ruler Ladder (Thermo Fisher Scientific, United States) as the size marker and was ran at 99V for 35 mins. The process was continued with gel visualization using Bio-Rad Universal Hood II Gel Doc System and the digital image was obtained.
7
Quantitative Reverse Transcription PCR Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The PCR amplifications were performed in 25 μl reaction volumes containing 2.5 μl of 10Χ Qiagen PCR buffer (Tris·Cl, KCl, (NH4)2SO4, 15 mM MgCl2; pH 8.7), 0.5 μl dNTP mix (10 mM each), 2 μl gene specific forward and reverse primers (Table S7 ) mixture (5 μM each), 0.5 μl MgCl2 (25 mM), 3 μl cDNA (1:10 diluted) as a template, 16.3 μl nuclease-free water and 0.2 μl Taq DNA polymerase (25 Units). The PCR reaction mixtures were subjected to amplification cycles on BIO-RAD C1000 Touch™ thermal cycler (BIO-RAD, CA, USA) using the thermal cycler conditions of initial denaturation at 94 °C for 15 min, 35 cycles of denaturation at 94 °C for 30 s, annealing at 59 °C for 30 s and extension at 72 °C for 45 s followed by final extension at 72 °C for 10 min. The PCR amplicons were loaded on 1% denaturing TAE agarose gel pre-stained with ethidium bromide using 5 μl of PCR product mixed with 1 μl 6X loading dye (Promega). To estimate the size of DNA samples 100 bp DNA ladder (Promega) was run on the agarose gel alongside the samples. To visualize PCR amplification product, the gel was exposed to UV light using an ImageQuant LAS 4000 (GE Life Sciences) imaging system and the gel images were captured using ImageQuant LAS 4000 software (GE Life Sciences).
8
Genomic DNA Extraction from Leaves
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA (gDNA) was isolated from young unfolding leaf tissues. About 1 g of fresh leaf tissue was grounded into a fine powder in prechilled mortar and genomic DNA from individual accession was extracted using, DNAeasy Plant Mini Kit (QIAGEN, USA). The DNA extraction was performed in accordance with the manufacturer's instruction. DNA concentration were determined comparatively by electrophoresis at current of 100 amps, 80 volts, for 40 minutes using agarose gel (0.8 %) electrophoresis, by applying 5 μl gDNA loaded after mixing with 3 μl 6X loading dye (Promega, USA) to check the quality of the DNA by comparing the intensity of the bands with a 1kb standard (Thermo Scientific, USA). The gel was visualized under a UV transilluminator and the gel was imaged with a gel documentation system (Ingenius-3, Syngene, USA) to confirm the quality of the genomic DNA.
9
Reverse Transcription and PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Reverse transcription of RNA into cDNA was performed using GoScript Reverse Transcriptase kit (Promega, Madison, WI, USA ref. A5001) with a MasterCycler Pro S thermocycler (Eppendorf, Hamburg, Germany). The PCR were carried out in a final volume of 10 μL, containing 2 μL of cDNA template, using an AmpliTaq polymerase from LifeTech (Ref. N80800166). For amplification, 40 cycles (at 94 °C for 30 s, 55 or 60 °C for 30 s, and 72 °C for 30 s) were conducted. HLA‐G and actin (ATCB) primers are described in Table 1 . ATCB amplification was performed as control in all the experiments. The PCR amplification product was mixed with 6× loading dye (Promega; ref. G1881) and analyzed on 2% agarose gel stained with 2 μL of ethidium bromide at 1 mg·mL−1 for 100 mL of agarose gel. The molecular weight marker used was 1 kb plus DNA ladder from Invitrogen, Carlsbad, CA, USA (Ref. 10787018). Imaging was performed using a ChemiDoc XRS System (Bio‐Rad, Hercules, CA, USA), and interpretation using imagelab software (Bio‐Rad).
10
Agarose Gel Electrophoresis and PCR Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A total of 5 μL of PCR product and 1 μL of 6× loading dye (Promega, Madison, WI, USA) were loaded into a single well of a 1.2% agarose gel. To facilitate size quantitation of amplicons, 10 μL of 1 kbp DNA Ladder (Bioline, Taunton, MA, USA) was also run. Each gel was subjected to electrophoresis prior to ethidium bromide staining and visualization under ultraviolet light. ExoSAP-IT® (USB® Products, Cleveland, OH, USA), which digests any unincorporated primer and dNTPs, was used to purify amplicons. A total of 1 μL of ExoSAP-IT® was combined with every 5 μL of PCR product and incubated as per the manufacturer's instructions. Purified samples were quantitated using the Agilent 2100 Bioanalyzer and the Agilent DNA 1000 kit (Agilent Technologies, Santa Clara, CA, USA) following the manufacturer's protocol.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!