Validation of hydroxymethylation at the PTEN promoter was performed in an independent sample group (four nevi and four melanoma metastases). Genomic DNA (1 μg) was subjected to BS and OxBS conversion using TrueMethyl oxBS Module (NuGEN Technologies, Redwood City, CA, USA). DNA was amplified using the PCRX Enhancer System (Thermo Fisher Scientific, Waltham, MA, USA) and subjected to capillary sequenced (primers: GGGGTTGTAAATAGATTTGATAGG and AAAAATATCTCCTACTACAACCCAAAA) and deep paired‐end sequencing (tailed primers: GATGTGTATAAGAGACAGGGGGTTGTAAATAGATTTGATAGG and CGTGTGCTCTTCCGATCTAAAAATATCTCCTACTACAACCCAAAA) using a MiSeq system (Illumina).
Truemethyl oxbs module
Manufactured by Tecan
Sourced in United States
The TrueMethyl oxBS module is a laboratory instrument designed for the analysis of DNA methylation. It is used to perform oxidative bisulfite sequencing, a technique that provides detailed information about the epigenetic modifications in DNA samples.
Automatically generated - may contain errors
Lab products found in correlation
Qubit ssdna assay, by Thermo Fisher Scientific (4 mentions)
Pyromark q48 advanced cpg reagent, by Qiagen (3 mentions)
Pyromark q48 autoprep software, by Qiagen (3 mentions)
Acetonitrile, by Thermo Fisher Scientific (3 mentions)
Pyromark q48 autoprep apparatus, by Qiagen (3 mentions)
Pyromark assay design software, by Qiagen (3 mentions)
Truemethyl magnetic beads, by Thermo Fisher Scientific (2 mentions)
Infinium methylationepic beadchip, by Illumina (2 mentions)
Pcrx enhancer system, by Thermo Fisher Scientific (1 mentions)
Miseq system, by Illumina (1 mentions)
Auto hmedip kit, by Diagenode (1 mentions)
Gentra puregene kit, by Qiagen (1 mentions)
Dneasy blood tissue kit, by Qiagen (1 mentions)
Ez dna methylation kit, by Zymo Research (1 mentions)
Hiscansq system, by Illumina (1 mentions)
Qubit 3.0 fluorometer, by Thermo Fisher Scientific (1 mentions)
Dneasy blood and tissue kit, by Qiagen (1 mentions)
Bioanalyzer high sensitivity dna analysis kit, by Agilent Technologies (1 mentions)
Hiseq 4000, by Illumina (1 mentions)
Hiseq 3000 sequencer, by Illumina (1 mentions)
14 protocols using truemethyl oxbs module
1
Validating PTEN promoter hydroxymethylation
2
Quantitative analysis of 5-hydroxymethylcytosine
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Oxidative bisulfite treatment (oxBS) of 1 μg of DNA was performed with TrueMethyl oxBS Module (Nugen), as described in (29 (link)). Levels of 5-hydroxymethylcytosine (5hmC) were measured by pyrosequencing and they were calculated by subtracting the proportion of Cs obtained in oxBS from BS (5hmC% = 5mC%BS – 5mC%oxBS). For hydroxymethylated DNA immunoprecipitation (hMeDIP) total DNA was extracted using the Gentra Puregene kit (Qiagen), 1.25 μg of which were sonicated for 6 cycles [15 s ON/90 s OFF] on a Bioruptor Pico. 5hmC was immunoprecipitated using 2.5 μg of anti-5hmC antibody as per the manufacturer's instructions (Auto hMeDIP Kit, Diagenode). The enrichment was measured using qPCR that was performed as previously described in (28 ) following these conditions: denaturation 95°C 5min, amplification [95°C 15 s, 60°C 60 s, 72°C 60 s] × 40 cycles, melting curve 95°C 60 s, 55–90°C with 0.5°C increment every 5 s. The percentage of precipitated 5hmC over input was calculated as such as the result of 2^[(Ct(10%input) – 3.32) – Ct(hmetDNA-IP)] × 100%.
3
DNA Methylation Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from tissue samples using the DNeasy Blood & Tissue Kit (QIAGEN, Hilden, Germany), following the manufacturer’s protocol. After quantification, 1000 ng of genomic DNA were converted with sodium bisulfite using an EZ DNA Methylation Kit (ZYMO RESEARCH, Irvine, CA, USA). In order to monitor the efficiency of the bisulfite conversion of DNA, the unmethylated control gene M13mp18, a synthetic gene with a known number of methylation sites, was converted, processed and sequenced together with the samples. Oxidative bisulfite conversion for 5-hmC detection was performed using the TrueMethyl oxBS module (Nugen, Tecan, CA, USA) following the manufacturer’s instructions.
4
Oxidative Bisulfite Sequencing of PDLCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The oxidative bisulfite conversion reaction was performed using TrueMethyl oxBS Module (catalog #0414, NuGEN, Tecan Genomics, Inc., Redwood City, CA, USA). Samples from the control DMEM groups (DMEM) were pooled separately for both l-PDLCs and h-PDLCs, combining 500 ng of each replicate. For the induced group (OM), the replicates were run independently, totaling 3 OM samples for each PDLC population. Then, 1 µg of DNA was purified and denatured, according to the manufacturer’s specifications. DNA from each group was split in two equal tubes of reactions, one of which underwent chemical oxidation followed by bisulfite conversion, the other underwent mock oxidation (oxidant replaced by water) followed by bisulfite conversion. This allows distinguishing between DNA methylation and hydroxymethylation. Next, the Infinium Methylation EPIC BeadChip (Illumina Inc., San Diego, CA, USA) kit was employed, and all reactions were processed according to EPIC array protocol. Array bead chips were scanned on Illumina HiScan SQ System (Illumina Inc., San Diego, CA, USA).
5
Selective 5mC detection using oxBS conversion
6
Selective 5mC detection using oxBS conversion
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To selectively detect 5mC modification, genomic DNA was subjected to oxBS conversion (Booth et al., 2012 (link)) using TrueMethyl oxBS module (NuGEN Technologies) as per the manufacturer’s recommendations. In short, genomic DNA was affinity-purified using 80% acetonitrile (Fisher Scientific) and TrueMethyl magnetic beads to eliminate potential contaminating compounds. After the denaturation step, genomic DNA was oxidized to convert 5-hydroxymethylcytosine to 5-formylcytosine. Bisulfite treatment was then carried out to convert 5-formylcytosine to uracil, leaving 5-methylcytosine intact. Following desulfonation and purification, converted DNA was quantified using Qubit ssDNA assay (Invitrogen). PCR amplification of oxBS converted DNA was carried out with biotin-labeled primers. Primer design was carried out using PyroMark Assay Design software (version 2.0, QIAGEN). Pyrosequencing of biotinylated PCR products was performed using PyroMark Q48 Advanced CpG reagents (QIAGEN) on a PyroMark Q48 Autoprep apparatus (-QIAGEN) following the manufacturer’s protocol. 5mC levels at CpG sites were determined using PyroMark Q48 Autoprep software (version 2.4.2, QIAGEN) in CpG Assay mode. All samples were prepared, amplified and sequenced in triplicates. PCR and pyrosequencing primers are listed in Table S2 .
7
Quantitative DNA Methylation Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA from each clone of similar passage numbers was extracted using DNeasy Blood and Tissue kit (Catalog ID 69504; Qiagen, Hilden, Germany). DNA was quantified with Qubit 3.0 Fluorometer (Life Technologies, CA, USA). ∼2 μg of DNA underwent oxidative-bisulfite conversion to measure both 5mC and 5hmC using the TrueMethyl OxBS Module (Catalog ID 0414-32; Nugen, CA, USA). Epigenome-wide DNA methylation profiling was performed using the Infinium MethylationEPIC Bead Chips (Illumina, Inc., CA, USA) at the Norris Cotton Cancer Center Genomics Shared Resource Core.
8
Bisulfite Sequencing Protocol
9
Quantitative DNA Methylation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TrueMethyl oxBS module (NuGEN Technologies) as per the manufacturer's recommendations.
In short, genomic DNA was affinity-purified using 80% acetonitrile (Fisher Scientific) and
TrueMethyl magnetic beads to eliminate potential contaminating compounds. After the denaturation step, genomic DNA was oxidized to convert 5-hydroxymethylcytosine to 5formylcytosine. Bisulfite treatment was then carried out to convert 5-formylcytosine to uracil, leaving 5-methylcytosine intact. Following desulfonation and purification, converted DNA was quantified using Qubit ssDNA assay (Invitrogen). PCR amplification of oxBS converted DNA was carried out with biotin-labeled primers. Primer design was carried out using PyroMark Assay Design software (version 2.0, Qiagen). Pyrosequencing of biotinylated PCR products was performed using PyroMark Q48 Advanced CpG reagents (Qiagen) on a Pyromark Q48 Autoprep apparatus (Qiagen) following the manufacturer's protocol. 5mC levels at CpG sites were determined using PyroMark Q48 Autoprep software (version 2.4.2, Qiagen) in CpG Assay mode.
All samples were prepared, amplified and sequenced in triplicates. PCR and pyrosequencing primers are listed in Supplementary Tables 3 and4.
In short, genomic DNA was affinity-purified using 80% acetonitrile (Fisher Scientific) and
TrueMethyl magnetic beads to eliminate potential contaminating compounds. After the denaturation step, genomic DNA was oxidized to convert 5-hydroxymethylcytosine to 5formylcytosine. Bisulfite treatment was then carried out to convert 5-formylcytosine to uracil, leaving 5-methylcytosine intact. Following desulfonation and purification, converted DNA was quantified using Qubit ssDNA assay (Invitrogen). PCR amplification of oxBS converted DNA was carried out with biotin-labeled primers. Primer design was carried out using PyroMark Assay Design software (version 2.0, Qiagen). Pyrosequencing of biotinylated PCR products was performed using PyroMark Q48 Advanced CpG reagents (Qiagen) on a Pyromark Q48 Autoprep apparatus (Qiagen) following the manufacturer's protocol. 5mC levels at CpG sites were determined using PyroMark Q48 Autoprep software (version 2.4.2, Qiagen) in CpG Assay mode.
All samples were prepared, amplified and sequenced in triplicates. PCR and pyrosequencing primers are listed in Supplementary Tables 3 and4.
10
Genome-Wide DNA Methylation Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA were treated with sodium bisulfite following the TrueMethyl® oxBS Module (Tecan Genomics Inc, Redwood City, CA). Converted DNA were hybridized to Infinium HumanMethylationEPIC BeadChips. Raw idat files from the EPIC arrays were processed using preprocessNoob function in minfi in R59 (link). Copy number variations of tumor samples were estimated in comparison to non-tumor samples using the CNV.fit function in conumee package in R60 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!