The largest database of trusted experimental protocols

Hiscript q select rt supermix for pcr

Manufactured by Vazyme
Sourced in China

HiScript Q Select RT SuperMix for PCR is a reverse transcription (RT) reagent kit designed for cDNA synthesis from RNA templates. It includes an optimized buffer, reverse transcriptase enzyme, and RNase inhibitor to facilitate efficient and reliable cDNA production for subsequent PCR amplification.

Automatically generated - may contain errors

Lab products found in correlation

2 protocols using hiscript q select rt supermix for pcr

1

Chicken Spleen-Derived scFv Generation

Check if the same lab product or an alternative is used in the 5 most similar protocols
The spleen tissue from the hen with the highest IgY titer was collected to extract the total RNA by using Total RNA Kit (Tiangen Biotech, Beijing, China), and the first-strand cDNA was synthesized by HiScript Q Select RT SuperMix for PCR (Vazyme Biotech, Nanjing, China). The heavy variable fragment (VH) and light chain variable fragment (VL) genes were amplified by PCR with primers HF-Sfi I and HR-Linker, LF-Linker and LR-Not I, respectively (Table 1). The VH and VL which both contained the sequence of a peptide linker were assembled to scFv with primers HF-Sfi I and LR-Not I by Overlap PCR.

Primers used for PCR

NamePrimer sequences (5ʹ–3ʹ)Application
HF-Sfi IATGTCTATGGCCCAGCCGGCCGTGACGTTGGACGVH
HR-LinkerCAGAGCCACCTCCGCCTGAACCGCCTCCACCGGAGGAGACGATGACTTCGGVH
LF-LinkerTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGATCGGCGCTGACTCAGCCGTCCTVL
LR-Not IAGTTACTGGAGCGGCCGCACCTAGGACGGTCAGGGVL
+ Open protocol
+ Expand
2

Construction of Chicken ScFv Antibody

Check if the same lab product or an alternative is used in the 5 most similar protocols
The hen’s spleen was collected to extract the total RNA by Total RNA Kit (Tiangen Biotech, Beijing, China), and the first-strand cDNA was synthesized by HiScript Q Select RT SuperMix for PCR (+gDNA wiper, Vazyme Biotech, Nanjing, China). The heavy variable fragment (VH) and light chain variable fragment (VL) genes were amplified by PCR with primers (Table 1). The VH and VL were assembled with primers HF-EcoR I & LR-Hind III by Overlap PCR. The products of overlap PCR (scFv) were purified through Gel Extraction Kit (Omega, Norcross, GA, USA). This protocol was performed as described in [14 (link)].

Primers used for PCR.

NamePrimer sequences (5′-3′)Application
HF-EcoR ICGGAATTCGGCCGTGACGTTGGACGVH
HR-LinkerCAGAGCCACCTCCGCCTGAACCGCCTCCAVH
CCGGAGGAGACGATGAC
LF-LinkerTTCAGGCGGAGGTGGCTCTGGCGGTGGCGVL
GATCGGCGCTGACTCAGCCGTCCT
LR-Hind IIIAATAAGCTTACCTAGGACGGTCAGGGVL
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!