Abi 7500 pcr system

The whole RNA was generated from cultured cells using a TRIzol Kit, based on the specification of the manufacturers (Invitrogen, USA). Then, 2 μg RNA was used to reverse transcribed into cDNA by using Reverse Transcription Kit (TaKaRa, Dalian, China). qPCR was performed on the ABI 7500 PCR System using SYBR qPCR Mix (TaKaRa). The housekeeping gene GAPDH was used for an internal control, and relative mRNA expression was calculated using 2^−ΔΔCt method. The primers were listed as below:

RNA was isolated using RNAiso (TAKARA). For quantitative PCR cDNA was synthesized using the iScriptTM Reverse Transcription Supermix (Bio-Rad). Realtime PCR was performed by ABI 7500 PCR system using SYBR Green Master Mix (TAKARA). The thermal profile is 50°C for 2min, 95°C for 2 min, 45 cycles of 95°C for 15 sec and 60°C for 40 sec. β-actin was used as the endogenous calibrator. Relative fold change was calculated using 2-ΔΔCt method. Experiments were done in triplicated. The primer sequences are as follows: Six1 forward, 5ʹ AAGGAGAAGTCGAGGGGTGT 3ʹ, Six1 reverse, 5ʹ TGCTTGTTGGAGGAGGAGTT 3ʹ; MMP2 forward, 5ʹ TGTGTTCTTTGCAGGGAATGAAT 3ʹ, MMP2 reverse, 5ʹ TGTCTTCTTGTTTTTGCTCCAGTT 3ʹ. GLUT3 forward, 5ʹ CCTTTGGCACTCTCAACCAGC 3ʹ, GLUT3 reverse, 5ʹ AACCCAGTAGCAGCGGCCAT 3ʹ. Snail forward, 5ʹ GCCCACCTCCAGACCCAC 3ʹ, Snail reverse, 5ʹ GCAGGGACATTCGGGAGAA 3ʹ. β-actin forward, 5ʹ ATAGCACAGCCTGGATAGCAACGTAC 3ʹ, β-actin reverse, 5ʹ CACCTTCTACAATGAGCTGCGTGTG 3ʹ.