Log In Sign up
The largest database of trusted experimental protocols

Topflash reporter

Manufactured by Addgene
Visit Supplier
Sourced in United States

The TOPflash reporter is a plasmid construct that contains a luciferase reporter gene under the control of a promoter responsive to the Wnt/β-catenin signaling pathway. It is used to measure Wnt/β-catenin pathway activity in cells.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions) Dual luciferase reporter gene assay kit, by Keygen Biotech (1 mentions) Pgl4.73 hrluc sv40, by Promega (1 mentions) Pgc1α, by Addgene (1 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions) 24 well plate, by Corning (1 mentions) Dual glo luciferase assay system, by Promega (1 mentions)

4 protocols using topflash reporter

1

Luciferase-based Transcriptional Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
TOP/Flash reporter, CCND1 promoter, TCF4/TCF7L2, and LEF1 cDNAs were purchased from Addgene. ESRRG cDNA has been described previously39 (link),40 (link). For luciferase-based reporter assays, cells were transfected with indicated reporter genes and plasmids using Lipofectamine 3000 (Invitrogen, Grand Island, NY) in accordance with the manufacturer’s instructions. After 48 h, cells were harvested for measurement of luciferase activity with a Promega kit (E1605).
Kang M.H., Choi H., Oshima M., Cheong J.H., Kim S., Lee J.H., Park Y.S., Choi H.S., Kweon M.N., Pack C.G., Lee J.S., Mills G.B., Myung S.J, & Park Y.Y. (2018). Estrogen-related receptor gamma functions as a tumor suppressor in gastric cancer. Nature Communications, 9, 1920.
+ Open protocol
+ Expand
2

Dual Luciferase Assay for FKBP3 Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
When the cells grew to 90% confluency, HEK‐293 cells and DB cells were seeded in 12‐well plates. HEK‐293 cells were transfected with plasmids and Lipo8000 transfection reagent. Plasmids included TOPflash reporter (Addgene, Cambridge, MA, USA), pRL‐TK, vector 1 or oeFKBP3. In another experiment, the promoter region of FKBP3 was cloned into the pGL3‐enhancer reporter vector and then co‐transfected into DB cells with FOXO3 overexpression plasmid and pRL‐TK. After 48 h, cells were lysed for the luciferase assay and the assay was performed using a dual luciferase reporter gene assay kit (KeyGEN).
Xing X., Liu M., Wang X., Guo Q., Wang H, & Wang W. (2023). FKBP3 aggravates the malignant phenotype of diffuse large B‐cell lymphoma by PARK7‐mediated activation of Wnt/β‐catenin signalling. Journal of Cellular and Molecular Medicine, 28(1), e18041.
+ Open protocol
+ Expand
3

Wnt/β-catenin Signaling Pathway Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Wnt/β-catenin TOPFlash reporter (Addgene, 12,456) and mutant FOPFlash reporter (Addgene, 12,457) were transfected into indicated cells, along with thymidine kinase (TK), antisense oligo or control oligo. 36 h later, cells were lysed and detected with dual-detection luciferase detection kit (Promega Corporation, cat. no. E1910). Wnt/β-catenin activation was measured according to the fold change of TOPFlash versus the FOPFlash control.
Fu X., Zhu X., Qin F., Zhang Y., Lin J., Ding Y., Yang Z., Shang Y., Wang L., Zhang Q, & Gao Q. (2018). Linc00210 drives Wnt/β-catenin signaling activation and liver tumor progression through CTNNBIP1-dependent manner. Molecular Cancer, 17, 73.
+ Open protocol
+ Expand
4

Luciferase Assay for Transcriptional Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
1kb Axin2 promoter reporter, TOPflash reporter, PGC1α, PPARγ expression vector, and control EGFP were from Addgene. The internal control vector pGL4.73 [hRluc/SV40] was from Promega. siRNA against PGC1α (#ASO0W515), PPARγ (#ASO0W516), and Axin2 (#ASO0WAZI) and the negative control (#AM4642) were obtained from Ambion. For plasmid transfection, electroporation was performed (Invitrogen). For siRNA transfection, siRNA duplexes were transfected with lipofectamine 2000. To generate reporter construct without the predicted PPRE, the fragment without the PPRE was amplified using the primer set: Forward, CCGGGCTAGCCAAGTCAGCAGGGGC, and Reverse, CCGGTACCGGGAGGAGTGGGAAGACAGAGGTG. Then the amplified fragment was cloned into pGL3-basic vector using the Nhe1 and Xho1 sites. To conduct the luciferase assay, cells were seeded in 24-well plates (Corning) at a density of 2×105 cells per well one day before transfection. Reporter constructs and overexpression vectors or siRNAs were co-transfected at indicated concentrations using Lipofectamine® 2000 per manufacturer’s protocol (Invitrogen). After 48 hrs, firefly and Renilla luciferase activities were measured with Dual-Glo luciferase assay system per manufacturer’s instructions (Promega).
Hu L., Yang G., Hägg D., Sun G., Ahn J.M., Jiang N., Ricupero C.L., Wu J., Rodhe C.H., Ascherman J.A., Chen L, & Mao J.J. (2015). IGF1 Promotes Adipogenesis by a Lineage Bias of Endogenous Adipose Stem/Progenitor Cells. Stem cells (Dayton, Ohio), 33(8), 2483-2495.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!