Rps6 42mer

Manufactured by Merck Group

The RPS6 42mer is a lab equipment product manufactured by Merck Group. It is a synthetic oligonucleotide sequence consisting of 42 nucleotides that corresponds to a portion of the ribosomal protein S6 (RPS6) gene. The RPS6 42mer can be used as a tool in various research applications, but a detailed description of its intended use or functionality is not provided.

Automatically generated - may contain errors

Lab products found in correlation

Pabpc1, by Merck Group (1 mentions)

2 protocols using rps6 42mer

Crystallization and Biochemical Assays of RNA Oligonucleotides

Check if the same lab product or an alternative is used in the 5 most similar protocols

The RNA oligonucleotides used for crystallization and biochemical assays were as follows:
RPS6 8mer (IDT (Coralville, IA)): 5’ CUUUUCCG 3’
RPS6 42mer (Sigma-Aldrich):
5’ CCUCUUUUCCGUGGCGCCUCGGAGGCGUUCAGCUGCUUCAAG 3’.
G-RPS6 was T7-transcribed from a DNA template to generate the RNA sequence:
5’ GCCUCUUUUCCGUGGCGCCUCGGAGGCGUUCAGCUGCUUCAAG 3’.
RPL32 was T7-transcribed from a DNA template designed with a self-cleaving 5’ hammerhead ribozyme to generate a 5’ C, resulting in the final RNA sequence:
5’ CUCUCUUCCUCGGCGCUGCCUACGGAGGUGGCAGCCAUCUCC 3’.

Lahr R.M., Fonseca B.D., Ciotti G.E., Al-Ashtal H.A., Jia J.J., Niklaus M.R., Blagden S.P., Alain T, & Berman A.J. (2017). La-related protein 1 (LARP1) binds the mRNA cap, blocking eIF4F assembly on TOP mRNAs. eLife, 6, e24146.

+ Open protocol

+ Expand

Biochemical assays with RNA oligonucleotides

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA oligonucleotides used in the biochemical assays contained the following 5′-3′ sequences: A₁₆ (AAAAAAAAAAAAAAAA) (Sigma), U₁₆ (UUUUUUUUUUUUUUUU) (Sigma), RPS6–20mer (CCUCUUUUCCGUGGCGCCUC) (Sigma), RPS6–42mer (CCUCUUUUCCGUGGCGCCUCGGAGGCGUUCAGCUGCUUCAAG) (T7 in vitro transcribed), RPS6 ΔTOP (GUGGCGCCUCGGAGGCGUUCAGCUGCUUCAAG) (T7 in vitro transcribed), PABPC1 (CCCCUUCUCCCCGGCGGUUA) (Sigma), RPL13A (CACUUCUGCCGCCCCU) (IDT).

Lahr R.M., Mack S.M., Héroux A., Blagden S.P., Bousquet-Antonelli C., Deragon J.M, & Berman A.J. (2015). The La-related protein 1-specific domain repurposes HEAT-like repeats to directly bind a 5′TOP sequence. Nucleic Acids Research, 43(16), 8077-8088.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!