Bigdye terminator reagents

Genomic DNA was extracted from auricular or tail biopsies, as described [20 (link)]. For genome-wide mapping, genomic DNA was amplified by PCR using a panel of 91 single nucleotide polymorphism (SNP) loci arranged in chromosome sets, and the products were analysed by pyrosequencing, as described [20 (link)]. Individual exons of Kl were amplified from genomic DNA by PCR using gene-specific primers and Taq PCR Mastermix (Qiagen, Crawley, UK), and the PCR products sequenced using BigDye terminator reagents and ABI 3100 sequencer (Life Technologies, Carlsbad, USA). For genotyping, DNA was amplified using Taq PCR Mastermix (Qiagen, Crawley, UK), as described [20 (link)]. Primers utilized to amplify exon 1, which contained the kl^203X mutation were: forward 5’- CCCACTACCGCTTCTCCATA -3’ and reverse 5’- AGTAGGTTGTGGGCAACCAG-3’. Primers utilized to amplify exon 4, which contained the kl^604N mutation were: forward 5’-GCTAACAGTTGCTCTGTTCTTTG-3’ and reverse 5’- CCACCACTGGAGTGATGTTG -3’. PCR products were digested with PstI and DpnII restriction enzymes, respectively, and separated by agarose gel electrophoresis before image acquisition using a Gel Doc UV transilluminator (Bio-Rad, Hemel Hempstead, UK), as described [26 (link)].