APC knockout (KO) RKO or WiDr cell lines were generated using CRISPR/Cas9 methodology28 (link). Briefly, annealed oligonucleotides (CRISPR single guide RNA sequences; sgRNA), targeting the APC exon 15 were cloned into the lentiCRISPRv2 (Addgene). The sequences of sgRNA were as follows: sgRNA-1 5′-CACCGTCGCTCTTCATGGATTTTTA-3′; sgRNA-2 5′-AAACTAAAAATCCATGAAGAGCGAC-3′. HEK293T cells were transfected with the lentiCRISPRv2 containing the APC sgRNA and packing vectors pMD2G and psPAX2 at a 2:2:1 ratio for viral production. Then, RKO or WiDr cell lines were transduced with the APC-lentivirus and selected with puromycin (Sigma-Aldrich) to generate the stable cell lines. For generation of PKM2 knockdown (KD) cell lines, PKM2 shRNAs were designed by Bionics (shPKM2 #1, GCCATCTACCACTTGCAATTA; shPKM2 #2, GCCATAATCGTCCTCACCAAG). APC KO-RKO and -WiDr cells were transfected with pGPU6/hygro (shCON) or two independent pGPU6/hygro-PKM2 (shPKM2) vectors, and then selected in a medium containing hygromycin B (1 μg/ml; Duchefa). Of those, PKM2 shRNA #1 was used for real-time PCR analysis, glucose consumption, lactate secretion assays, and mouse xenograft assay. SW480 cells were transfected with the control shRNA or PKM2 shRNA #1 and then selected in a medium containing hygromycin B (1 μg/ml; Duchefa).
Hygromycin b
Manufactured by Duchefa Biochemie
Sourced in Germany, United States, Netherlands
Hygromycin B is an antibiotic substance produced by the bacterium Streptomyces hygroscopicus. It acts as a selective agent in the culture of eukaryotic cells, inhibiting protein synthesis and causing cell death in non-resistant cells.
Automatically generated - may contain errors
Lab products found in correlation
Puromycin, by Merck Group (3 mentions)
Lenticrispr v2, by Addgene (2 mentions)
Phusion high fidelity dna polymerase, by Thermo Fisher Scientific (2 mentions)
L histidine, by Merck Group (1 mentions)
Cantharidin, by Abcam (1 mentions)
Murashige and skoog, by Merck Group (1 mentions)
Gelrite, by Duchefa Biochemie (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (1 mentions)
Ab5392, by Abcam (1 mentions)
Ab97959, by Abcam (1 mentions)
Nb100 2220, by Novus Biologicals (1 mentions)
E8640, by Merck Group (1 mentions)
Sc 47778, by Santa Cruz Biotechnology (1 mentions)
Sc 9996, by Santa Cruz Biotechnology (1 mentions)
P0067, by Merck Group (1 mentions)
Bml cm110, by Enzo Life Sciences (1 mentions)
Mab1580, by Merck Group (1 mentions)
Monarch dna gel extraction kit, by New England Biolabs (1 mentions)
Lr clonase 2, by Thermo Fisher Scientific (1 mentions)
20 protocols using hygromycin b
1
Generation of APC and PKM2 Knockout Cell Lines
2
Cloning and Transformation of PGD2 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The entire PGD2 region was amplified from genomic DNA using Phusion High-Fidelity DNA Polymerase (Finnzymes, ThermoFisher Scientific) and the indicated primer combination (listed in Supplementary Table S1 ). The genomic gPGD2 fragment was inserted into EcoRV-opened pBluescript SK and cloned in Escherichia coli XL1 blue cells (both from Stratagene). The gPGD2 fragment was released with SmaI and SalI, and inserted into the binary vector pGSC1704(HygR) via SnaBI and SalI, ligated and cloned in E. coli XL1 blue, and re-transformed into Agrobacterium tumefaciens strain GV2260 as described in Scharte et al. (2009) . Floral dip transformation of heterozygous plants was conducted as described by Clough and Bent (1998) (link). Transformed seedlings were selected on MS agar supplemented with 20 µg ml–1 hygromycin B (Duchefa Biochemie B.V, Haarlem, The Netherlands), and cultivated further until segregation analyses in the T2 generation.
3
Targeted Gene Disruption in Moss
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Transformation efficiency and APT targeting frequency were measured as previously described (41 (link)). Moss protoplasts (4.8 × 105) were transformed with the non-homologous pBHRF plasmid (41 (link)) digested with HindIII to produce a linear fragment containing the 35S::hygroR marker, or with the PpAPT-KO2 plasmid digested with BsaAI/HindIII to produce the targeting APT fragment containing the 35S::hygroR cassette (from pBHRF) flanked by genomic PpAPT sequences. Targeted integration of PpAPT-KO2 at the APT genomic locus confers resistance to 2-FA. We selected primary transformants (unstable + stable) with 25 mg/l hygromycin B (Duchefa). Integrative transformants were isolated following a second round of selection. Small pieces of protonemal tissue from these transformants were then transferred onto medium containing 5 μM of 2-FA to detect APT GT events. Experiments were repeated three times and statistically analysed using the χ2 test.
4
N. crassa Growth Conditions and Media
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
General protocols for growth media and growth conditions for N. crassa have been previously described (Davis, 2000 ) and are also available at the Fungal Genetics Stock Center1 . Strains used in this study are listed in Table 1 . All strains, excluding MYC-PPH1, were grown in either liquid or solid (supplemented with 1.5% agar) Vogel’s minimal medium, with 1.5% (w/v) sucrose (VgS). The MYC-PPH1 strain was grown in liquid Vogel’s minimal medium with 0.1% glucose, supplemented with 0.17% arginine and 0.01 M quinic acid, at pH 5.8 (Cheng et al., 2001 (link)). When required, the medium was supplemented with 10 μg/ml hygromycin B (Duchefa), 100 mM cantharidin (Abcam Biochemicals) or 100 μg/ml L -histidine (Sigma–Aldrich).
5
Determining Antibiotic Sensitivity of H. fraxineus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To test the sensitivity of H. fraxineus NW-FVA 1856 to hygromycin and geneticin for the subsequent selection of transformants, growth was tested on AMS containing increasing concentrations of the respective antibiotics using either mycelium plugs or protoplasts. For hygromycin (hygromycin B, Duchefa Biochemie), concentrations ranging from 25 to 200 µg/ml and for geneticin (geneticin disulphate (G418) solution, BioScience Grade, Carl Roth GmbH, Karlsruhe, Germany), concentrations in the range of 75–500 µg/ml were tested.
Single mycelium plugs (ø 0.3 cm) of H. fraxineus NW-FVA 1856 grown on AMS for 14 days at RT were inoculated on petri dishes (ø 6 cm) containing 5 ml of AMS excluding or including antibiotics with above mentioned concentrations. Plates were incubated at RT in the dark and the growth of mycelium was documented after 21 days.
Single mycelium plugs (ø 0.3 cm) of H. fraxineus NW-FVA 1856 grown on AMS for 14 days at RT were inoculated on petri dishes (ø 6 cm) containing 5 ml of AMS excluding or including antibiotics with above mentioned concentrations. Plates were incubated at RT in the dark and the growth of mycelium was documented after 21 days.
6
Seed Germination Modulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Surface-sterilized seeds were grown on half-strength Murashige and Skoog (MS) medium containing hygromycin B (40 mg/L, Duchefa, The Netherlands) for 3 days and transferred to half-strength MS containing ABA (2-cis-4-trans-abscisic acid, 98% synthetic, Sigma Aldrich, Burlington, MA, USA) or GA (90% gibberellin A3 basis, Sigma Aldrich, USA), then grown vertically from 4 to 6 days at 28 °C under 16 h light and 8 h darkness. After incubation at 28 °C, shoot and root lengths were measured.
7
Transgenic Rice Expressing GCaMP6f-mCherry
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
GCaMP6f was cloned into the plant expression vector pGWB554 using standard molecular techniques, as described previously (Choi et al., 2014 (link); Weigand et al., 2021 (link)). The resultant construct was transformed into rice cultivar Kitaake using Agrobacterium tumefaciens strain LBA4404. Briefly, 35S::GCaMP6f-mCherry (GCaMP6fmC) was delivered into rice calli using Agrobacterium-mediated transformation (Hiei et al., 1994 (link)). Transformed calli were selected on the half-strength Murashige and Skoog (1/2 MS; Sigma-Aldrich) medium (2.15 g of MS salts, 15 g of sucrose, and 3.5 g of Gelrite [Duchefa Biochemie] in 1 L of water) supplemented with 20 µg·mL-1 hygromycin B (Duchefa Biochemie). After root and shoot formation, rice seedlings were transferred to water and acclimated for 2 days. Rice seedlings were then transferred into pots containing Baroker soil (Seoul Bio) and raised in a growth chamber.
8
Establishment of Stable Cell Lines for EGFR Degradation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human fibroblast (M1) cells were grown in complete medium: DMEM (Bio Whittaker MD, Walkersville, US) supplemented with 10% FCS (Integro B. V., Zaandam, NL), 2mM L-glutamine, 25U/ml penicillin and 25 μg/mL streptomycin (Bio Whittaker MD, Walkersville, US) in a 5% CO2 incubator with 37 °C. Cells stable transfected with Ii-pMep4 (Invitrogen, Carlsbad, CA, US) were grown in medium containing 0.15 mg/mL Hygromycin B (Saaven & Werner AB, Linhamn, SE). M1 cells stably expressing Hrs-YFP/Eps15-GFP and Ii-pMep4 were grown in complete medium containing 0.2 mg/mL G418 bisulphate (Duchefa, Haarlem, NL) and 0.15 mg/mL Hygromycin B (Saaven & Werner AB, Linhamn, SE). All the FRAP experiments were done on cells stably expressing Hrs-YFP or Eps15-GFP. Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, US) was used according to the supplied protocol in all transfections when preparing the stable cell lines.
In the preparations of stabile cell lines, M1 cells were transfected with 1 μg DNA and 1.5 μl Lipofectamine 2000 (Invitrogen, Carlsbad, CA, US) ON, in 500 μl OptiMEM and 1.5 ml DMEM medium. Stable clones with expression of the respective constructs were tested to prove EGFR degradation. Clones with inhibited EGFR degradation were discarded.
In the preparations of stabile cell lines, M1 cells were transfected with 1 μg DNA and 1.5 μl Lipofectamine 2000 (Invitrogen, Carlsbad, CA, US) ON, in 500 μl OptiMEM and 1.5 ml DMEM medium. Stable clones with expression of the respective constructs were tested to prove EGFR degradation. Clones with inhibited EGFR degradation were discarded.
9
Autophagy and Neural Stem Cell Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Baf.A1 (BML-CM110, Enzo, USA), pepstatin A (PepA, P5318, Sigma-Aldrich, USA), E64d (E8640, Sigma-Aldrich), puromycin (NC9138068, Invitrogen, USA), hygromycin B (H0192, Duchefa, The Netherlands), fetal bovine serum (FBS, #101, Tissue Culture Biologicals, USA), forskolin (BML-CN100, Enzo), and retinoic acid (RA, #BML-GR100, Enzo) were purchased from the indicated companies. Horseradish peroxidase-conjugated β-actin (SC-47778, Santa Cruz Biotechnology, USA) and antibodies against ATG7 (#8558, Cell Signaling Technology, USA), LC3 (NB100-2220, Novus Biologicals, USA), p62 (P0067, Sigma-Aldrich, USA), sex-determining region Y-box 2 (Sox2, ab97959, Abcam, UK), microtubule-associated protein 2 (MAP2, ab5392, Abcam), receptor interaction protein (RIP, MAB1580, Merck, USA), glial fibrillary acidic protein (GFAP, NBP1-05198, Novus Biologicals), nestin (bs-0008R-A555, Bioss, USA), and GFP (SC-9996, Santa Cruz Biotechnology) were purchased from the indicated companies.
10
Constructing 35Spro:IPT9 Transgene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To construct the 35Spro:IPT9, the At5g20040 transcription unit was amplified from Col-0 cDNA using the Q5 High-Fidelity DNA Polymerase (NEB), as recommended by the manufacturer using the oligonucleotides attB_IPT9_F and attB_IPT9_R, that contained attB sites at their 5' ends (Supplementary Table 1 ). The PCR product obtained was purified using the Monarch DNA Gel Extraction Kit (NEB) and cloned into the pDONR207 using a BP Clonase II Kit (Thermo Fisher). Chemically competent Escherichia coli DH5α cells were transformed by the heat-shock method (Dagert and Ehrlich, 1979 (link)), and the structural integrity of the inserts carried by transformants was verified by Sanger sequencing. The insert cloned in the pDONR207 was subcloned into the pMDC32 Gateway-compatible destination vector (Curtis and Grossniklaus, 2003 (link)) via an LR Clonase II (Thermo Fisher) reaction. The transgene was mobilized into Agrobacterium tumefaciens GV3101 (C58C1 RifR) cells and those were used to transform Col-0, ipt9-1, and ipt9-2 plants by the floral dipping (Clough and Bent, 1998 (link)). T1 transgenic plants were selected on plates supplemented with 15 mg/L of hygromycin B (Duchefa).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!