Total RNA was extracted and cDNA was synthesized as described above. cDNA synthesis was verified by PCR. Primers for quantitative Real-Time PCR (qPCR) were designed to specifically amplify a 129 bp long fragment of the exon containing polymorphisms in P. collenchymatum (BRK1_for: GACAATCGCCATTTTTCGAG and BRK1_rev CACCGTTAGCTTCTCGTTCA). Each qPCR was carried out using the SensiMix HRM kit (Bioline, Lickenwalde, Germany) on a LightCycler480 (Roche, Mannheim, Germany) with the following parameters: 95 °C for 10 min, followed by 50 cycles of 95 °C, 60 °C and 72 °C, for 15 s each. High resolution melting analysis was subsequently carried out from 65 °C to 95 °C with a ramp rate of 0.02 °C/s. Melting curve data were analyzed using the Gene Scanning software (Roche, Mannheim, Germany) and a sensitivity setting of 0.4 with auto-grouping. Pre-melt and post-melt temperatures were chosen in the range of 77 °C and 84 °C respectively.
Gene scanning software
Manufactured by Roche
Sourced in Switzerland
The Gene Scanning Software is a bioinformatics tool designed for the analysis of genetic data. The software provides a comprehensive suite of algorithms and functionalities for the scanning and interpretation of genetic sequences.
Automatically generated - may contain errors
Lab products found in correlation
Lightcycler 480, by Roche (3 mentions)
Sensimix hrm kit, by Meridian Bioscience (1 mentions)
Seqstudio genetic analyzer, by Thermo Fisher Scientific (1 mentions)
Lightcycler 480 high resolution melting master mix, by Roche (1 mentions)
Lightcycler 96 system, by Roche (1 mentions)
Meltdoctor hrm master mix, by Thermo Fisher Scientific (1 mentions)
Lightcycler 96 real time pcr system, by Roche (1 mentions)
Takara ex taq hs, by Takara Bio (1 mentions)
Lightcycler 480 resolight dye, by Roche (1 mentions)
Qiaamp dna mini kit, by Qiagen (1 mentions)
Geneamp pcr system 9700, by Thermo Fisher Scientific (1 mentions)
11 protocols using gene scanning software
1
High-resolution melting analysis of BRK1 gene
2
Mutational Analysis of CRLF2 and JAK2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HRM analysis was performed on CRLF2 (exon 6) and JAK2 (exon 16) hotspots. All samples were tested in duplicate, positive and negative controls for each exon were included in each run. PCR was carried out using 40 ng of genomic DNA, 0.3 µM of each primer (Supplementary Table S3 ), 3 mM of MgCl2, and 1X LightCycler 480 High Resolution Melting Master Mix (Roche). Melting curves were analyzed using Gene Scanning software (Roche). All samples showing divergent melting curves were sequenced following standard protocols on a SeqStudio Genetic Analyzer (Applied Biosystems, Foster City, CA).
3
GNAS and KLF5 Mutation Screening
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
High-resolution melt analysis was used to screen for mutations at hotspot codon 201 of GNAS and in the coding exons of KLF5 (exons 1–4). For this, 15 ng WGA tumor DNA was amplified in duplicate using the primers listed in Additional file 1 : Table S4, followed by melt analysis on the LightCycler 480 Instrument using Gene Scanning Software (Roche). Samples with variant melt curves in duplicate PCRs were independently amplified using the same primers (KLF5) or an independent primer set (GNAS) and Sanger sequenced to confirm sequence variations.
4
Melting Curve Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Melting curve analysis was performed using the Gene Scanning Software (version 1.2, Roche Diagnostics) with “Gene scanning” and “Tm calling” tools. The normalization settings were the following: pre-melting normalization (76.42–77.37 °C), post-melting normalization (86.56–87.51 °C) and temperature shift with a threshold = 1. HRMA of both shape and peak height was performed in duplicate for each sample.
5
Methylation Analysis of HPV-16 L1 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sequence HPV-16 L1 localized from nucleotide (nt) 5576 to (nt) 5636 (NCBI accession no. NC_001526.2), which contains 4 CpG sites (nt 5602, nt 5608, nt5611, nt 5617), was tested.
Mixed the completely methylated and unmethylated HPV-16 L1 gene standards in 0%, 10%, 25%, 50%, 75%, and 100% methylated to unmethylated template ratios, which served as the methylation standards for MS-HRM.
Extracted the HPV viral DNA by DNA extraction kit.
The methylation standards and all extracted HPV viral DNA were bisulfite modified; the detailed steps referred to the instruction book of EpiTect Bisulfite Kit.
The specific PCR primers used were that, Forward primer:5′ GCGCATTATTGTTGATGTAGGTGATTTTTATTTATATTTTAG3′, reverse prime: 5′: GCCGCACTAAACAACCAAAAAAACATCTAAAAAAAAATA 3′. The detailed steps of MS-HRM PCR referred to the handbook of EpiTect HRM PCR.
The HRM data were analyzed using the Genescanning Software (Roche).[11 (link)]
6
High-Resolution Melting Curve Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HRM data were analyzed as fluorescence-versustemperature graphs using Gene Scanning software version 1.5.0 (Roche Applied Science GmbH). The melting-curve analysis comprised four steps: i) data normalization was conducted by selecting the linear regions of the melting curves before and after DNA dissociation, ii) data were adjusted by shifting the temperature axes of the normalized melting curves, iii) the relative signal difference versus temperature was plotted using the reference sample as a baseline, and iv) the E value was extracted for NCA evaluation (Figure 1).
7
Screening for SLC22A4 c.338G>A Variant
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Screening for the SLC22A4 c.338G>A (rs768484124) was performed on 125 audiologically tested normal-hearing controls. A specific primer pair was designed to PCR amplify a 265 bp genomic DNA fragment, encompassing the mutation site (primerF: 5′-CTGGCGCAACAACAGTGTC-3′; primerR: 5′-ACGCAGAGGGAGGGTCAG-3′). PCR amplicons were screened for mutations by HRM on a LightCycler 480 using the HRM Master kit (Roche, Basel, Switzerland) and a touch-down protocol. Thermal conditions for amplification are available on request. Amplicons were analyzed with the Gene Scanning Software (Roche).
8
High-Resolution Melting Analysis of DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HRM was performed using an HRM reagent (MeltDoctor HRM Master Mix; Thermo Fisher Scientific, Waltham, MA, USA), according to the manufacturer’s instructions. The second primer pair was as follows: Forward 5′-TTTCCTTTACAATCATATGGTTTCC-3′ and reverse 5′-GCTGGTGCATGTAGAAGTTCA-3′. Each DNA fragment was observed as a single, correctly sized band (98 bp). PCR amplification was performed as described previously (Aoki et al., 2021b (link)). We performed all reactions in duplicate using a real-time PCR system (LightCycler 96 System; Roche Diagnostics). The HRM curves were analyzed using Gene Scanning Software, version 1.1.0.1320 (Roche Diagnostics) under default settings. We acquired the normalized melting curve and melting peaks (−dF/dT) by setting the premelt and postmelt fluorescence at 100% and 0%, respectively.
9
Methylation Analysis of HPV-16 L1 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sequence HPV-16 L1 localized from nucleotide (nt) 5576 to (nt) 5636 (NCBI accession no. NC_001526.2), which contains 4 CpG sites (nt 5602, nt 5608, nt5611, and nt 5617) were tested.
Mixed the completely methylated and unmethylated HPV-16 L1 gene standards in 0%, 10%, 25%, 50%, 75% and 100% methylated to unmethylated template ratios, which served as the methylation standards for MS-HRM.
Extracted the HPV viral DNA by DNA extraction kit.
The methylation standards and all extracted HPV viral DNA were bisulfite modificated, the detailed steps referred to the instruction book of EpiTect Bisulfite Kit.
The specific PCR primers used were that, forward primer: 5′ GCGCATTATTGTTGATGTAGGTGATTTTTATTTATATTTTAG3′, reverse prime: 5′ GCCGCACTAAACAACCAAAAAAACATCTAAAAAAAAATA 3′. The detailed steps of MS-HRM PCR referred to the handbook of EpiTect HRM PCR.
The HRM data were analyzed using the Genescanning Software (Roche).
10
High-Resolution Melting Analysis of DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HRM was performed using a high-fidelity PCR enzyme (TaKaRa Ex Taq HS; TaKaRa Bio, Shiga, Japan) and HRM dye (LightCycler 480 ResoLight dye; Roche Diagnostics). Each reaction mixture (10 μL) contained 1 μL of the purified DNA fragments (1 × 104 copies/reaction), 400 nmol/L of each primer (Table S1), 3 mmol/L of MgCl2, 200 μmol/L of deoxynucleoside triphosphates (dNTPs), 0.025 U/μL of Ex Taq HS enzyme, 1× ResoLight dye, and 1× PCR buffer. All reactions were duplicated using a LightCycler 96 real-time PCR system (Roche Diagnostics). Symmetric PCR amplification was performed with an initial denaturation at 95°C for 5 min, followed by 45 cycles of denaturation at 95°C for 10 s, annealing at 60°C for 10 s, and extension at 72°C for 20 s. After amplification, HRM was performed with denaturation at 95°C for 60 s, cooling at 40°C for 60 s, preheating at 65°C for 1 s, and melting curve generation from 65°C to 95°C in 1°C/s increments with 25 acquisitions. Under default settings, HRM curves were analyzed using Gene Scanning software, version 1.1.0.1320 (Roche Diagnostics). Normalized melting peaks (−dF/dT) were acquired by setting premelt and postmelt fluorescence levels to 100% and 0%, respectively. After HRM analysis, each DNA fragment was observed as a single, correctly sized band (101 bp) by electrophoresis.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!