Rt pcr instrument

Total RNA was extracted from tissues and HCC cells using TRIzol (Thermo Fisher Scientific, USA), and then, cDNA was synthesized using a reverse-transcription kit (Thermo Fisher Scientific, USA). An RT-PCR instrument (Thermo Fisher Scientific, USA) was used to perform RT-PCR analysis according to the manufacturer’s instructions. The relative expression of target gene was calculated by using a method of comparing Ct (2^−ΔΔCT) values.

Reverse transcription were performed by the TaqMan High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems™, USA). The 20 μL reverse transcription reaction contained dNTPs, MultiScribe Reverse Transcriptase (50 U/μL), 10x Reverse Transcription Buffer, Random Primer, nuclease-free water, and 10 μL RNA. The reaction was carried out at 4 steps (Step 1: 25 °C, 10 min; Step 2: 37 °C, 120 min; Step 3: 85 °C, 5 min; Step 4: 4 °C, ∞) on Thermal Cycler (Bio-Rad, California, USA). In the present study, the reaction mix for each sample used of TaqMan, ^®Gene Expression, in a volume of 20 μL including in 4 μL preamplified of cDNA (50 ng), 1 μL of TaqMan gene expression assay, 5 μL of dH2O, and 10 μL of the Universal Master Mix (2x). The qRT-PCR reactions were accommodated in 96-well plates in the Applied Biosystems RT- PCR instrument. The assays were started by denaturation for 2 min at 50 °C, 10 min at 95 °C and followed by 40 cycles of 95 °C for 15 sec and 60 °C for 1 min. In addition, all probes (Applied Biosystems, Foster City, CA, USA) in this study, based on the mRNA sequences of target HER2, HSP90AA1, SIAH2, and reference gene GAPDH (Glyceraldehyde-3-phosphate dehydrogenase) acquired from GenBank database (http://www.ncbi.nlm.nih.gov/genbank/) (Table 1).

Total RNA was isolated using Trizol reagent (TaKaRa, Japan), and 1000 ng RNA was reverse-transcribed into cDNA using Primescript RT Reagent (TaKaRa, Japan). The RT-PCR was performed using FastStart Universal SYBR Green Master (Roche, Switzerland) in a RT-PCR instrument (Applied Biosystems, USA), and β-Actin was used as endogenous control. The following PCR primers were used:
TIPARP forward, 5′-TGCACCCAGTTTCAAGTGAT3-′
TIPARP reverse, 5′- GTTCACCAGCTCAAACACGA3-′
β-Actin forward, 5′-GCTGTGCT ATCCCTGTACGC3-′
β-Actin reverse, 5′-TGCCTCAGGGCAGCGGAACC3-′

The experimental rats were purchased from the Nanjing model animal center and grown for one month; cattle type II collagen (CII) was purchased from Sigma-Aldrich Co. (St. Louis, MO, USA); LTB4, IL-32, IFN-γ and chemokine MIP-1α, MCP-1 enzyme-linked immunosorbent assay (ELISA) kits all from Wuhan Boster Biological Technology Ltd. (Wuhan, China). Primary rabbit polyclonal LTB4 antibody (dilution, 1:1,000; cat. no. ab133040); rabbit polyclonal IL-32 antibody (dilution, 1:1,000; cat. no. ab37158); rabbit polyclonal IFN-γ antibody (dilution, 1:1,000; cat. no. ab77246); rabbit polyclonal MIP-1α antibody (dilution, 1:1,000; cat. no. ab171336); rabbit polyclonal MIP-1α antibody (dilution, 1:1,000; cat. no. ab30512) secondary goat anti-rabbit (HRP) IgG antibody (dilution, 1:2,000; cat. no. ab6721) were all purchased from Abcam Co. Ltd. (Cambridge, MA, USA). RNA-extraction reagents, reverse transcription kits and PCR enzymes were from Takara Co. Ltd. (Los Angeles, CA, USA); RT-PCR primers were forward, ATGTATTGCTAATCTTGATGTCTCTCGA and reverse, CTTTCAGAGAACTTTCTTGAGGCTTGTCCTAAAGTG GAG, synthesized by Nanjing Genscript Co. Ltd. (Nanjing, China); RT-PCR instrument was from Applied Biosystems (Foster City, CA, USA); flow cytometry was from Thermo Fisher Scientific (Attune NxT; Grand Island, NY, USA).