RNA extraction from cells or tissues was carried out using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.). RNA concentration and OD value of 2 µl RNA solution were determined using a NanoDrop™ 2000 ultra-micro spectrophotometer (NanoDrop Technologies; Thermo Fisher Scientific, Inc.). Reverse transcription was performed using PrimeScript RT Reagent kit (Takara Biotechnology Co., Ltd.) at 37°C for 45 min and at 85°C for 5 min. GAPDH was regarded as an internal reference. qPCR was performed using SYBR Premix EX Taq II (Takara Bio, Inc.) and the ABI 7900 fluorescence quantitative PCR instrument (Applied Biosystems; Thermo Fisher Scientific, Inc.). The thermocycling conditions were as follows: 94°C for 2 min; 40 cycles of 94°C for 15 sec and 60°C for 45 sec. Primer sequences are listed in Table I . The expression levels of LBX2-AS1, ELK1 and S100A11 were normalized to GAPDH, while miR-491-5p expression was normalized to U6. Relative expression levels were determined using the 2−ΔΔCq method (29 (link)).
Nanodrop 2000 ultra micro spectrophotometer
Manufactured by Thermo Fisher Scientific
Sourced in United States
The NanoDrop 2000 is an ultra-micro spectrophotometer designed for rapid and accurate quantification of small-volume samples. It utilizes a patented sample retention technology to enable direct measurement of nucleic acid or protein concentrations without the need for cuvettes or dilutions.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (11 mentions)
Primescript rt reagent kit, by Takara Bio (5 mentions)
Sybr green qpcr supermix, by Thermo Fisher Scientific (4 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (3 mentions)
Lightcycler 96 real time pcr system, by Roche (3 mentions)
Qiaamp dna mini kit, by Qiagen (2 mentions)
Sybr premix ex taq 2, by Takara Bio (2 mentions)
Fastgene rna premium kit, by Nippon Genetics (2 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (2 mentions)
Trizol reagent, by CoWin Biotech (2 mentions)
Hiscript 2 q rt supermix for qpcr, by Vazyme (2 mentions)
Qtower3 g quantitative real time pcr thermal cycler, by Analytik Jena (2 mentions)
Hiscript 2 q rt supermix for qpcr gdna wiper, by Vazyme (2 mentions)
Agencourt ampure xp magnetic beads, by Thermo Fisher Scientific (2 mentions)
Qiaamp dna mini kit tissue kit, by Qiagen (2 mentions)
Thunderbird next sybr qpcr mix, by Toyobo (2 mentions)
Flexigene dna kit, by Qiagen (2 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions)
Gel extraction kit, by Corning (1 mentions)
Microplate reader, by Agilent Technologies (1 mentions)
53 protocols using nanodrop 2000 ultra micro spectrophotometer
1
RNA Extraction and Gene Expression Analysis
2
Dental plaque microbiome profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total genomic DNA of the dental plaque biofilms were extracted using the QIAGEN QIAamp DNA mini kit (Qiagen, Hilden, Germany). The concentration and purity of the DNA was evaluated using a Nanodrop 2000 ultra-micro spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). The variable regions (V4-V5) of 16S rDNA were amplified using universal primers 515f (5’-GTGCCAGCMGCCGCGG-3’) and 907Rb (5’-CCGTCAATTCMTTTRAGTTT-3’). About 10-50 ng of DNA was used for PCR-amplification, and the PCR reaction conditions were as follows: initial denaturation at 94°C for 3 min, 35 cycles of denaturation at 94°C for 45s, annealing at 50°C for 1 min, elongation at 72°C for 1.5 min, and a final extension step at 72°C for 10 min. The PCR products were purified using the Gel Extraction Kit (AXYGEN, CA, USA). The quality and the purity of the DNA were evaluated using the Quant-iTPicoGreen dsDNA Assay Kit and the Microplate reader (BioTek, FLx800), respectively. The 16SrRNA library was prepared using the TruSeq Nano DNA LT Library Prep Kit (Illumina) and sequenced with 5% PhiX samples using Illumina MiSeq sequencers with 600 cycles.
3
Oral Maxillofacial Tumor DNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Samples of the current study were collected from the sharing platform for the tissue sample and bioinformatics database of oral maxillofacial tumors, the demographics was well recorded and Chi-square test was performed to identify potential confounders (Table 1 ), germ free procedures and operating environment were ensured to avoid possible contamination. The enrolled patients were assigned to young and elderly groups by age, and subjects with smoking or drinking history were excluded. Tongue cancer tissue samples were collected immediately after surgery, and all samples were stored at −80°C within 20 min for further use. Total genomic DNA of the tumor samples was extracted using the QIAGEN QIAamp DNA mini kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. The concentration and purity of the DNA was assessed by a Nanodrop 2000 ultramicro spectrophotometer (NanoDrop Technologies, Wilmington, DE, United States).
4
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was exacted with TRIzol Reagent (Invitrogen). After assessing the concentration of RNA with a Nanodrop 2000 ultra-microspectrophotometer (Thermo), 2 μg total RNA was reversed as cDNA using a HiScript II Q RT SuperMix for qPCR (+gDNA wiper) kit. Quantitative PCR with reverse transcription (RT–qPCR) was conducted with ChamQ Universal SYBR qPCR master mix (Vazyme, R223-01, Q711-02) on the CFX96 real-time PCR system (Bio-Rad). All data were calculated by the 2ΔΔCt method. Primers are listed in Supplementary Table 5 .
5
VEGF Plasmid Isolation and Exosome Engineering
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The plasmid gene of pEGFP-kozVEGF165 (VEGF) was a gift from Professor Kun Ma lab (Dalian University of Technology, China). The VEGF plasmid DNA was isolated and identified as previously reported 28 . In brief, the VEGF plasmid was propagated in E. coli DH5α cells. A single isolated colony of E. coli DH5α from a freshly streaked plate was picked to inoculate an appropriate volume of LB medium containing the appropriate antibiotic, and then incubated for overnight with vigorous shaking (~300 rpm, 37 °C; shaking incubator). The VEGF plasmid was isolated and purified using the Endo-Free Plasmid Mini Kit II (OMEGA, USA) as described in the kit manual. The DNA concentration was determined using a NanoDrop 2000 Ultramicro spectrophotometer (Thermo, USA). For electroporation, 30 µg of exosomes and 10 µg of VEGF were mixed in 400 μL of electroporation buffer (1.15 mM potassium phosphate pH 7.2, 25 mM potassium chloride, 21% Optiprep) and subsequently electroporated at 1000 V, 5 ms with one pulse condition using a Gene Pulser Xcell Electroporation System (BioRad, USA). After electroporation, the engineered exosomes were purified at 25,000×g for 1 h at 4 °C.
6
Evaluating Pluripotency Markers in r-AdMSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ability of the r-AdMSCs harvested from various sites to express the pluripotency genes was tested using reverse-transcriptase PCR (RT-PCR). Octamer-binding transcription factor 4 (Oct4), embryonic stem-cell-specific homeobox protein (Nanog), SRYbox-containing gene 2 (Sox 2), reduced expression 1 (Rex-1), and telomerase reverse transcriptase (Tert) genes were utilized. To assess the efficacy of PCR, β-actin was employed as a control (Table 2 ). Total RNA from r-AdMSCs of the third passage from different harvesting sites was isolated using the FastGene RNA Premium Kit (Nippon Genetics, Tokyo, Japan). The quantity and quality of RNA were assessed using a NanoDrop 2000 ultra-micro spectrophotometer (Thermo Fisher Scientific, Cambridge, MA, USA). Then, the cDNA was synthesized via the reverse transcription of 1 µg of RNA (OD260/OD280 ≈ 2.0) by applying the ReverTra Ace™ qPCR RT Master Mix kit (Toyobo Co., Ltd., Osaka, Japan). For PCR amplification, the resultant cDNA was utilized. PCR cycling was accomplished in a Veriti Thermal Cycler (Thermo Fisher Scientific, Waltham, MA, USA) according to [30 (link)]. All examinations were carried out in triplicate. To visualize the PCR products, gel electrophoresis was performed (Figure 7 ).
7
Quantitative Analysis of PI3K/AKT/mTOR Pathway
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from SUNE1 cells using TRIzon Reagent (Beijing ComWin Biotech, Co., Ltd., Beijing, China). The quality and quantity of RNA was examined with a NanoDrop-2000 ultramicrospectrophotometer (NanoDrop; Thermo Fisher Scientific, Inc., Wilmington, DE, USA) at wavelengths of 260 and 280 nm. Subsequently, 1 mg RNA was reverse transcribed into cDNA using the SuperRT cDNA Synthesis kit (Beijing ComWin Biotech, Co., Ltd.) according to the manufacturer's protocol, and qPCR was carried out with SYBR Green qPCR SuperMix (Invitrogen; Thermo Fisher Scientific, Inc.) in CFX96™ Real-Time PCR Detection system (Bio-Rad Laboratories, Inc.). The thermocycling conditions were as follows: 95°C for 5 min, followed by 40 cycles of 95°C for 30 sec and 60°C for 30 sec, and a final extension at 72°C for 5 min. The relative expression of genes was normalized to GAPDH using the 2−ΔΔCq method (16 (link)). The primers for RT-qPCR were as follows: GAPDH forward, 5′-TGACTTCAACAGCGACACCCA-3′ and reverse, 5′-CACCCTGTTGCTGTAGCCAAA-3′; PI3K forward, 5′-GCCCAGGCTTACTACAGAC-3′ and reverse, 5′-AAGTAGGGAGGCATCTCG-3′; AKT forward, 5′-CTCATTCCAGACCCACGAC-3′ and reverse, 5′-ACAGCCCGAAGTCCGTTA-3′; and mTOR forward, 5′-CTGGGACTCAAATGTGTGCAGT-3′ and reverse, 5′-GAACAATAGGGTGAATGATCCGGG-3′.
8
Profiling miRNA Expression in Breast Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Our laboratory research sample: 20 patients and 40 samples (20 before and 20 after chemotherapy) of frozen blood of patients with breast cancer that was collected before and after chemotherapy respectively and stored in low-temperature refrigerators (− 80 °C) were randomly sampled from the First Affiliated Hospital and Third Affiliated Hospital of Jinzhou Medical University from May 2017 to August 2018. The purpose of this study was to compare the results of our selected study samples with online available published data.
Reagents: The miRcuit hsa-miRNA isolation kit (Cat# DP501), miRcuit hsa-miRNA First-Strand cDNA Synthesis Kit (Cat# KR201) and miRcuit hsa-miRNA Detection Kit (SYBR Green) (Cat# FP401) was purchased from TransGen Biotech (Beijing,China); Water-DEPC treated from Beijing Solarbio Science & Technology Co., Ltd. (Beijing,China); and the miRNA primers were designed and synthesized by Changchun Jing Mei Biological Engineering Co. Ltd. (Changchun, China).
Instruments: The Nanodrop 2000 ultra-micro spectrophotometer (Thermo, USA), Stepone quantitative PCR instrument (ABI, USA); and Bioptic Qsep100 automatic nucleic acid analyzer (BiOptic, Taiwan).
Reagents: The miRcuit hsa-miRNA isolation kit (Cat# DP501), miRcuit hsa-miRNA First-Strand cDNA Synthesis Kit (Cat# KR201) and miRcuit hsa-miRNA Detection Kit (SYBR Green) (Cat# FP401) was purchased from TransGen Biotech (Beijing,China); Water-DEPC treated from Beijing Solarbio Science & Technology Co., Ltd. (Beijing,China); and the miRNA primers were designed and synthesized by Changchun Jing Mei Biological Engineering Co. Ltd. (Changchun, China).
Instruments: The Nanodrop 2000 ultra-micro spectrophotometer (Thermo, USA), Stepone quantitative PCR instrument (ABI, USA); and Bioptic Qsep100 automatic nucleic acid analyzer (BiOptic, Taiwan).
9
Quantitative Real-Time PCR Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genes were assessed by using SYBR Premix Ex Taq II reagent Kit (Tli RNaseH Plus) (Takara, Dalian, China). Briefly, total RNA extraction was performed by using total RNA isolation kit RP5611 (Bioteke, Beijing, China). RNA content and purity were detected by NanoDrop 2000 ultra-micro spectrophotometer (Thermo Fisher Scientific, Cambridge, MA, USA). After erasing genomic DNA, the first-strand cDNA was obtained by using reverse transcription kit PrimeScript RT reagent Kit RR047A (Takara, Dalian, China). Then, the CFX96 Touch™ Fluorescence quantitative real-time PCR system (Bio-Rad, Hercules, CA, USA) was used to detect the relative expression of genes. The mRNA relative expression was quantified by 2−△△Ct method. The genes and primers used in the study are mentioned in Additional file 1 : Table S1.
10
Quantitative Real-Time PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted by TRIzol method, the integrity of total RNA was detected by Gel Doc XR Gel imaging system (Bio-Rad, Hercules, CA, USA), the concentration and purity of total RNA were determined by Nanodrop 2000 ultra-micro spectrophotometer (Thermo Scientific, USA). The cDNA synthesis was performed by according to its specification. Quantitative Real-Time PCR (qRT-PCR) was performed with CFX96 Touch™ fluorescent quantitative PCR instrument (Bio-Rad). The PCR reaction procedure was as follows: 98 °C 30s, 98 °C 5s, 60 °C 5s, 40 cycles. The relative gene expression was calculated by 2−ΔΔCT (Schmittgen & Livak, 2008 (link)). The primers sequence were as follows: GAPDH, forward: 5′GGCCTCCAAGGAGTAAGACC3′, reverse: 5′AGGGGAGATTCAGTGTGGTG3′; ERGIC3, forward: 5′GGAGAGGTACTGAGGACAAATCA3′, reverse: 5′AGCTCATAGAGGACGAAGACTC3′.
Cells in each group were collected, and an appropriate amount of RNAiso Plus lysate (TakaRa Biotechnology, Beijing, China) was added and transported to Shenzhen BGI Co., Ltd on dry ice. Total RNA extraction and quality control, mRNA enrichment, library construction and quality control were completed by Shenzhen BGI Co., Ltd.
Cells in each group were collected, and an appropriate amount of RNAiso Plus lysate (TakaRa Biotechnology, Beijing, China) was added and transported to Shenzhen BGI Co., Ltd on dry ice. Total RNA extraction and quality control, mRNA enrichment, library construction and quality control were completed by Shenzhen BGI Co., Ltd.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!