Ab192985

The enrichment of H3K27me3 in the miR-139 promoter was investigated using the ChIP kit (Millipore Corp, Billerica, MA, USA). Cells were fixed with 1% formaldehyde, followed by ultrasonication (10 s on, 10 s off, 15 pulses). After centrifugation at 13,000 rpm, the supernatant was collected and transferred to three tubes containing the positive control antibody, the negative control IgG antibody, the target protein specific H3K27me3 (ab192985, Abcam, Cambridge, UK), respectively. After overnight incubation at 4 °C, the endogenous DNA-protein complex was precipitated by the protein agarose/sepharose. Then the supernatant was removed after centrifugation, and the non-specific DNA-protein complex was rinsed. The crosslinking was reversed overnight at 65℃, and the DNA fragment was purified and extracted based on a phenol/chloroform procedure. The INPUT was used as the loading control, and the miR-139 gene promoter-specific primers are shown in Table 1.

Primary antibodies used in this study are as follows: UTX (33510S, Cell Signaling Technology; GTX121246, GeneTex), COP1 (A300-894A, Bethyl), CUL1 (SC-17775, Santa Cruz Biotechnology), CUL2 (A5308, Abclonal), CUL3 (2759, Cell Signaling Technology), CUL4A (AB60215a, Abgent), CUL4B (A6198, Abclonal), CUL5 (SC-373822, Santa Cruz Biotechnology), EMP1 (ab230445 and ab202975, Abcam), AUTS2 (25,001–1-AP, Proteintech), Ki67 (ab15580, Abcam), EZH2 (ab191080, Abcam), VEGFC (A2556, Abclonal), Caspase-9 (A0281, Abclonal), Bcl2 (15,071, Cell Signaling Technology), DDB2 (ab181136, Abcam), DCAF7 (ab138490, Abcam), DCAF13 (ab195121, Abcam), H3K27me3 (ab192985, Abcam; A2363, Abclonal), H3 (ab1791, Abcam), P27 (610,241, BD), HA-Tag (51,064–2-AP, Proteintech; SC-7392, Santa Cruz Biotechnology), Flag-Tag (F7425-0.2MG, Sigma; F3165-1MG, Sigma), GFP (66,002–1-Ig, Proteintech), Myc-Tag (16,286–1-AP, Proteintech), α-tubulin (SC-23948, Santa Cruz Biotechnology), and Vinculin (V4505, Sigma). The chemical inhibitors MG132 (S2619), MG101 (S7386), MLN4924 (S7109), Baf-A1 (S1413), and GSK126 (S7061) were purchased from Selleck.

2 × 10⁶ HeLa cells and 4 × 10⁶ K562 cells were seeded one day before infection. Virus supernatants (15 µl) were pre-treated with 5 U/ml DNase I (#M6101; Promega) for 1 h at 37 °C. Medium was supplemented with 8 µg/ml Polybrene (#TR-1003-G; Millipore-Sigma). Virus and Polybrene were removed after 5 h. Cells were washed twice and harvested for ChIP approximately 24 h after infection. ChIP protocol was performed as previously described [11 (link)]. Following ChIP-grade antibodies were used with a concentration of 5 µg per 50 µg sonicated chromatin: Anti-H1.4 ([D4J5Q]; #41328S; Cell Signaling Technology); Anti-H3 (#ab1791; Abcam); Anti-H3K9me3 (#ab8898; Abcam); Anti H3 acetyl K9 + K14 + K18 + K23 + K27 (#ab47915; Abcam); Anti-H3K27me3 (#ab192985; Abcam); Rabbit IgG isotype control (#02-6102; Invitrogen). 5 µl of eluted DNA per sample were used for qPCR. PCR protocol and primers were used as described above. Additionally, beta globin specific primers served as a heterochromatin control (for 5’ CAGAGCCATCTATTGCTTAC 3’, rev: 5’ GCCTCACCACCAACTTCATC 3’). Data were determined relative to input DNA with the 2^ΔCt method and presented as percentage relative to input DNA in the bar graphs.

Chromatin immunoprecipitation (ChIP) assays were conducted using the ChIP Kit (ab500, Abcam) and primary antibodies against H3K36me2 (ab176921, 2 µg, Abcam) or H3K27me3 (ab192985, 2 µg, Abcam) following the provided manual. The enriched DNA was detected using qPCR as above described with the primers 5′-GTCTGGCTCCATCCTCATCT-3′ (sense) and 5′-CTCTCTCACACACCCTCTCC-3′ (antisense) for WNT10B promoter.

Chromatin immunoprecipitation (ChIP) was performed with an EZ‐ChIP kit (Upstate Biotechnology, USA) following the manufacturer's instruction. Antibodies against EZH2 (ab191250) and H3 trimethyl Lys 27 (H3K27me3, ab192985) were purchased from Abcam. Premier Primer 5.0 was used to design the CDH1 promoter primers that bind adjacent to the transcriptional start site, and the ChIP primers were obtained from RiboBio. The primers used for the ChIP assay are available in Table S1. A Magnetic RNA‐Protein Pull‐Down kit (Pierce, USA) was utilized to conduct RNA pull‐down experiments following the manufacturer's protocol. The biotinylated RNA used to detect SNHG1 was obtained from RiboBio (Guangzhou).

Antibodies used in this study include H3K27ac (Abcam, ab177178, recombinant; Abcam, ab4729, polyclonal) and H3K27me3 (Abcam, ab192985, recombinant). We found that antibody specificity is critical for high-quality signals of single-cell histone data. For H3K27ac, although the recombinant antibody yielded a higher fragment number per cell than the polyclonal antibody, its enrichment at TSSs or ChIP–seq peaks was lower (Extended Data Fig. 6e). Therefore, except for replicate 1 of the mouse frontal cortex dataset, all other experiments targeting H3K27ac were performed with the polyclonal antibody. One microgram of antibody was used per Droplet Paired-Tag reaction.

Mouse lung tissues were fixed in 4% paraformaldehyde and serial 3-μm-thick paraffin-embedded sections were used for immunofluorescence. The samples were deparaffinized and rehydrated, and lung sections were blocked using 1% sheep serum at room temperature for 1 h. Next, the sections were incubated with anti-JMJD3 (1:200, NBP1-06640, Novus, USA), anti-H3K27me3 (1:200, ab192985, Abcam, Cambridge, UK), anti-C/EBPβ (1:200, 23431-1-AP, Proteintech, USA), anti-cleaved caspase 3 (1:200, 9664S, CST, Boston, USA), anti-F4/80(ab16911, Abcam, Cambridge, UK), anti-ADORA2A (1:200, ab34611, Abcam, Cambridge, UK), and anti-H3K27me3 (ab6002, Abcam, Cambridge, UK) antibodies overnight at 4 °C. The next day, the sections were incubated with the appropriate secondary antibodies (1:200, ab15007, ab150079, ab150160, and ab150115; Abcam, Cambridge, UK) for 2.5 h at room temperature. Subsequently, the samples were incubated with 4′,6-diamidino-2-phenylindole (DAPI) to label the nuclei. Besides, the cells in lung tissue with F 4/80+ were recognized as macrophages. Immunofluorescence was observed under a fluorescence microscope (Olympus, Tokyo, Japan). Different groups of lung tissue were observed in the same settings and differences among groups were compared. Image-Pro Plus was used for image merging and was semi-quantitatively analysed by the ImageJ software (NIH, Bethesda, MD, USA).