Ribomax large scale rna production system t7 kit

RNAi experiment was conducted according to the method by Suzuki et al.^{28 (link)} with some modifications. Firstly, DNA segments were produced by PCR. The primers were dsFam20C-F and dsFam20C-R; dsGFP-F and dsGFP-R. fam20C gene and gfp segment were produced from the mantle cDNA and pEGFP-C1(Clontech) respectively. Next, dsRNA was transcribed from DNA segment by RiboMaX^TM Large Scale RNA Production System (T7) Kit (Promega) following manufacturer’s instructions. Then the synthesized dsRNA products were diluted to 80 μg/100 μL and 160 μg/100 μL by 0.1 M PBS. 100 μL of dsRNA was injected into four oysters for RNAi and 0.1 M PBS was injected as the control. All oysters were killed after six days and mantle tissues were collected. The shells were sampled after 6 days after RNAi experiment because it usually took about 6 days for the growth of new shells. We want to check the effect of fam20C knockdown on the new generated shells. Therefore, the time point of 6 days were chosen and the method has been used for RNAi experiment of matrix proteins^{28 (link)}. The methods of RNA extraction, reverse transcription and real-time PCR were mentioned above. The shells were collected for further scanning electron microscope (SEM) observation.

The sgRNA was designed by CRISPRdirect (http://crispr.dbcls.jp/, accessed on 6 July 2021) and synthesized using the RiboMAXTM Large Scale RNA Production System T7 kit (Promega, Madison, USA). A single guide RNA (sgRNA) targeting a specific site was designed in the second coding sequence of BmorCPAP1-H (Figure 6a), and then we simultaneously injected the sgRNA and Cas9 proteins into newly laid embryos (G0 generation). To identify the mutation site and type of larvae edited by CRISPR/Cas9, we used the appropriate primer sets (F: AACCGTACAATGCCTAA; R: GGGTTTATACTAGATTCACAG) to clone and sequence the genomic DNA.

Six pairs of gene‐specific primers were designed based on sequence information obtained from Influenza Sequence Database (http://www.flu.lanl.gov). The designed primers were analysed and filtered using the Premier 5.0 (Primer, Montreal, Canada), NCBI Primer Blast (NCBI, Bethesda, MD, USA) and Oligo 7.0 (Biolytic, Fremont, CA, USA) tool. Each gene‐specific primer was fused at the 5′ end to a universal sequence to generate six pairs of chimeric primers, and one pair of universal primers was used for RT‐PCR (Table 2). The AIV universal primers were designed to correspond to a highly conserved region of the matrix (M) gene, and the H5 primers were designed in a specific region of the HA gene segment for the H5 serotype. The other four pairs of primers were designed to correspond to the specific region of an NA gene segment for each of the NA types: N1, N2, N6 and N8. Primer synthesis and HPLC purification was performed by Invitrogen (Guangzhou, China).
Plasmids harbouring genes from AIV (H5N1 AIV Re‐1, H5N2 AIV chicken/QT35/87, H3N6 AIV Duck/HK/526/79/2B, H6N8 AIV Duck/HK/531/79) were used to produce ssRNA via in vitro transcription using a RiboMAXTM large‐scale RNA production system‐T7 kit (Promega, Madison, WI, USA). The copy numbers of the ssRNAs for the target genes of AIV (M, H5, N1, N2, N6 and N8) were calculated according to previous methods.20, 21

pGL3 plasmids (pGL3_Control) containing the specific UTRs cloned upstream of the luciferase gene were provided by GeneArt/Invitrogen (Ratisbonne, Germany).
UTR sequences were amplified by polymerase chain reaction (PCR) from pGL3 plasmids using primers designed to include the T7 promoter sequence upstream of the UTR PCR fragment (primers listed in Supplementary Table S1). PCR products were purified from agarose gel using the Nucleospin Gel and PCR Clean-up Kit (Macherey-Nagel). The DNA fragments generated by PCR were used as templates to produce the corresponding RNA sequences with Ribomax Large Scale RNA Production System-T7 Kit (Promega).

sgRNAs were designed using the CHOP-CHOP online utility (http://chopchop.cbu.uib.no/). sgRNA targeting sites are shown in Fig. 1. As described in a recent publication [23 (link)], the DNA template for T7 promoter used to drive in vitro transcription was constructed by PCR. Briefly, a customized oligonucleotide containing the T7 promoter and the sgRNA target sequence (N₂₀ or N₁₈) was designed as a forward primer with the sequence 5′-TAATACGACTCACTATAGG(N₂₀ or N₁₈)GTTTTAGAGCTAGAAATAGC. The T7 promoter sequences are underlined. The reverse primer was 5′-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3′. sgRNA synthesis was performed using a RiboMax large scale RNA production system—T7 kit (Promega, cat. P1300), following the manufacturer’s instructions.

We inserted the cDNA of AtHKT1 from the Col-0 and Tsu-1 alleles into the SmaI site of the expression vector pGEMHE. The capped cRNA was transcribed using the RiboMAX Large Scale RNA Production System-T7 kit (P1300, Promega, Wisconsin, USA). The cRNA quality was verified using agarose gel electrophoresis. The concentration was determined at 260 and 280 nm and adjusted to a final concentration of 0.8 μg μl^-1. We injected freshly isolated X. laevis oocytes with 23 nL of cRNA and used the oocytes for voltage-clamp experiments 3–4 days later. Electrophysiological experiments were conducted using a two-electrode voltage clamp amplifier as described previously [9 (link)]. We bathed the oocytes in a solution containing 6 mM MgCl₂, 1.8 mM CaCl₂, 10 mM MES-Tris (pH 5.5), 185 mM D-mannitol and 10 mM Na-glutamate salts. The voltage protocols used are described in the figure legends.