Genomic DNA was prepared from 1x108 cells according to standard protocols and digested with ApaI/XhoI, ApaI/NcoI and ApaI/SacII (New England Biolabs) for analysis of CEB1-1.8 I, CEB1-1.8 II and CEB1Gmut-1.7, respectively [31 (link), 63 (link)]. The digested DNA was resolved in 1% agarose gel and blotted onto Hybond-XL membrane (GE Healthcare). After transfer, the membrane was cross-linked with UV and hybridized with CEB1-0.6 and CEB1 Gmut probes for CEB1-1.8 and CEB1Gmut -1.7, respectively. 32P labelling of DNA probes was performed by random priming using Klenow fragment exonuclease (New England Biolabs), in presence of [α-32P]-CTP and hybridizations were performed in Church buffer at 55°C. Radioactive signals were detected using a BIORAD molecular imager FX.
Klenow fragment exonuclease
Manufactured by New England Biolabs
The Klenow fragment exonuclease is a DNA polymerase enzyme derived from the Escherichia coli DNA polymerase I. It retains the 5' to 3' polymerase activity of the parent enzyme but lacks the 5' to 3' exonuclease activity, making it useful for a variety of DNA manipulation and amplification techniques.
Automatically generated - may contain errors
Lab products found in correlation
Hybond xl membrane, by GE Healthcare (3 mentions)
Apai sacii, by New England Biolabs (1 mentions)
Restriction enzyme, by New England Biolabs (1 mentions)
Indicated restriction enzymes, by New England Biolabs (1 mentions)
Ampure xp beads, by New England Biolabs (1 mentions)
Pfu ultra 2 fusion dna polymerase, by Agilent Technologies (1 mentions)
End repair mix, by New England Biolabs (1 mentions)
Nextseq, by Illumina (1 mentions)
Quick ligase, by New England Biolabs (1 mentions)
4 protocols using klenow fragment exonuclease
1
Genomic DNA Digestion and Southern Blot Analysis
2
Southern Blot Analysis of Genomic DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was prepared from 2 × 108 cells according to standard protocols and digested with the indicated restriction enzymes (New England Biolabs). The digested DNA was resolved in a 1.2% agarose gel and blotted onto a Hybond-XL membrane (GE Healthcare). After transfer, the membrane was cross-linked with UV and hybridized with different probes listed in Supplemental Table 2 . 32P labeling of DNA probes was performed by random priming using Klenow fragment exonuclease-(New England Biolabs), in presence of [α−32P]CTP and hybridizations were performed in Church buffer at 65 °C for Telo and subtelomeric (STE1) probes and 55 °C for chromosomal probes. For spotting assays, several dilutions of genomic DNA were directly spotted onto a Hybond-XL membrane (GE Helathcare). Radioactive signal were detected using a Biorad molecular imager FX.
3
Genomic DNA Digestion and Southern Blotting
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was prepared from 2 × 108 cells according to standard protocols and digested with the indicated restriction enzymes (New England Biolabs). The digested DNA was resolved in a 1.2% agarose gel and blotted onto a Hybond-XL membrane (GE Healthcare). After transfer, the membrane was cross-linked with UV and hybridized with different probes. 32P labeling of DNA probes was performed by random priming using Klenow fragment exonuclease- (New England Biolabs), in presence of [α-32P]CTP and hybridizations were performed in Church buffer at 65°C for Telo/STE1 and STE1 (STE1 = Subtelomeric Element 1) probes and 55°C for chromosomal probe. For spotting assays, genomic DNA were directly spotted onto a Hybond-XL membrane (GE Healthcare). Radioactive signal was detected using a Biorad molecular imager FX.
4
Illumina Library Preparation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Library preparation was carried out as described45 (link). Briefly, sonicated DNA was subjected to a 50 µl end repair reaction using 1 µl End repair mix (NEB, #E6050L), cleaned by 1.8 × Ampure XP beads, followed by a 50-µl A-tail reaction, using 2 µl Klenow fragment exo-nuclease (NEB, #M0212L). Products were cleaned by 1.8 × beads and ligated by 2 µl quick ligase (NEB, #M2200) to 0.75 µM Illumina compatible forked indexed adapters. Ligation products were size selected by 0.7 × PEG (considering the PEG in the ligation buffer) in order to remove free adapters. 12–19 cycles of amplification were performed by PFU Ultra II Fusion DNA polymerase (Agilent, #600670) with the following Primers:
P7: 5’ AATGATACGGCGACCACCGAGATCTACACT CTTTCCCTACACGAC 3’; P5: 5’ CAAGCAGAAGACGGCATACGAGAT 3’. Amplified DNA was size selected for 300–700 bp fragments by taking the supernatant after using 0.5 × beads (which removed fragments greater than 700 bp), followed by a 1.0 × cleaning to remove remaining primers and adapter dimers. The final quality of the library was assessed by Qubit and TapeStation. Libraries were pooled and sequenced on NextSeq (Illumina) by 75 bp paired-end sequencing, generating ~10 M reads per library.
P7: 5’ AATGATACGGCGACCACCGAGATCTACACT CTTTCCCTACACGAC 3’; P5: 5’ CAAGCAGAAGACGGCATACGAGAT 3’. Amplified DNA was size selected for 300–700 bp fragments by taking the supernatant after using 0.5 × beads (which removed fragments greater than 700 bp), followed by a 1.0 × cleaning to remove remaining primers and adapter dimers. The final quality of the library was assessed by Qubit and TapeStation. Libraries were pooled and sequenced on NextSeq (Illumina) by 75 bp paired-end sequencing, generating ~10 M reads per library.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!