RNA from purified microglia and astrocyte cell cultures, or from brain tissue was extracted using an RNeasy Mini Kit (Qiagen, Valencia, CA) or TRIzol reagent (Invitrogen, Carlsbad, CA), respectively. cDNA was synthesized with 0.5 to 1.0 µg of total RNA using Superscript III reverse transcriptase (Invitrogen) and oligo d(T)12–18 primers (Sigma-Aldrich). PCR was performed with the SYBR Advantage qPCR master mix (ClonTech, Mountain View, CA). The PCR conditions for the M×3000P QPCR System (Stratagene, now Agilent Technologies, La Jolla, CA) were: 1 denaturation cycle at 95°C for 10 s; 40 amplification cycles of 95o for 10 s, 60o annealing for 10 s, and elongation at 72°C for 10 s; followed by 1 dissociation cycle. The relative product levels were quantified using the 2−ΔΔCt method (Livak and Schmittgen 2001 (link)) and were normalized to the housekeeping gene hypoxanthine phosphoribosyl transferase (HPRT).
Sybr advantage qpcr master mix
Manufactured by Takara Bio
Sourced in United States
SYBR Advantage qPCR master mix is a pre-formulated reagent solution for quantitative real-time PCR (qPCR) applications. It contains all the necessary components, including a DNA polymerase, SYBR Green I dye, and buffer system, to perform qPCR reactions.
Automatically generated - may contain errors
Lab products found in correlation
4 protocols using sybr advantage qpcr master mix
1
Quantitative RT-PCR Analysis of Gene Expression
2
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA from the brain tissue was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA), respectively. cDNA was synthesized with 1.0 μg of total RNA using Superscript III reverse transcriptase (Invitrogen) and oligo d(T)12–18 primers (Gene Link, Hawthorne, NY). PCR was performed with the SYBR Advantage qPCR master mix (ClonTech, Mountain View, CA). The PCR conditions for the Mx3000P QPCR System (Stratagene, now Agilent Technologies, La Jolla, CA) were as follows: 1 denaturation cycle at 95 °C for 10 s; 40 amplification cycles of 95 °C for 10 s, 60 °C annealing for 10 s, and elongation at 72 °C for 10 s, followed by 1 dissociation cycle. The relative product levels were quantified using the 2−∆∆Ct method [29 (link)] and were normalized to the housekeeping gene hypoxanthine phosphoribosyl transferase (HPRT).
3
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from primary glial cell cultures, or from brain tissue was extracted using an RNeasy Mini Kit (Qiagen, Valencia, CA) or TRIzol reagent (Invitrogen, Carlsbad, CA), respectively. The cDNA was synthesized from total RNA (1 μg) using Superscript III reverse transcriptase (Invitrogen) and oligo d(T)12–18 primers (Sigma-Aldrich, St. Louis, MO). The list of primers employed in the study is tabulated in Supplementary Table 1 . PCR was performed with the SYBR Advantage qPCR master mix (ClonTech, Mountain View, CA). The qPCR conditions were: 1 denaturation cycle at 95 °C for 10 s; 40 amplification cycles of 95 °C for 10 s, 60 °C annealing for 10 s, and elongation at 72 °C for 10 s; followed by 1 dissociation cycle (Mx3000 P QPCR System, Stratagene, now Agilent Technologies, La Jolla, CA). The relative expression levels were quantified using the 2−∆∆Ct method60 (link) and were normalized to the housekeeping gene hypoxanthine phosphoribosyl transferase (HPRT).
4
Comprehensive qRT-PCR Analysis of Immune Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from LSC (L3-L5) or DRG (L3-L5) tissue was extracted using an RNeasy Lipid Tissue Mini Kit (Qiagen, Valencia, CA, USA). The cDNA was synthesized from total RNA (1 μg) using Superscript III reverse transcriptase (Invitrogen) and oligo d(T)12–18 primers (Sigma-Aldrich, St. Louis, MO, USA). PCR was performed with the SYBR Advantage qPCR master mix (ClonTech, Mountain View, CA, USA). The qPCR conditions were 1 denaturation cycle at 95 °C for 10 s; 40 amplification cycles of 95 °C for 10 s, 60 °C annealing for 10 s, and elongation at 72 °C for 10 s followed by 1 dissociation cycle (Stratagene, now Agilent Technologies, La Jolla, CA, USA). The relative expression levels were quantified using the 2−∆∆Ct method [42 (link)] and were normalized to the housekeeping gene hypoxanthine phosphoribosyl transferase (HPRT). The primer sequences were 5′- TGCTCGAGATGTCATGAAGG -3′ sense, 5- AATCCAGCAGGTCAGCAAAG-3′ antisense for HPRT; 5′- ATGGCTGTTTCTGGCTGTTACTG-3′ sense, 5′-GACGCTTATGTTGTTGCTGATGG-3′ antisense for IFN-γ; 5′- CCAATGTGTCCATGTCATTT-3′ sense, 5′- CTTTCTCTCTCTGCTCATCGC -3′ antisense for BM5eco; 5′- GAGTGGCCAAGTTTCGATGTGG-3′ sense, 5′- CGGGGAAAAGGGAAGTGTCGAT-3′ antisense for BM5def; 5′-GACGCTCAACTTGTCCCAAAAC-3′ sense, 5′- GCAGCCGTGAACTTGTTGAAC-3′ antisense for MHCII and 5′- TGGCCACCTTGTTCAGCTACG-3′ sense, 5′- GCCAAGGCCAAACACAGCATA-3′ antisense for iNOS.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!