The qPCR assays were performed on an ABI 7500 platform (Applied Biosystems instruments, Grand Island, NY, USA)) with 25 μL reaction volumes containing 12.5 μL SYBR Green PCR master mix (Life Technologies, Grand Island, NY, USA cat# 4309155), 0.4 µM final concentration for primers (Forward Primer: 5′ CATGACTCCACCTGGACCTT 3′ and Reverse primer: 5′ GTGGGCGATGAAGTTCGTA 3′), 2.5 μL cDNA template, and 7.5 μL of water. The thermal cycle protocol used was as follows: 50 °C for 2 min, 10 min initial denaturation at 95 °C, and 40 cycles of 15 s denaturation at 94 °C, 1 min annealing at 58 °C. GAPDH was used as housekeeping gene for all the qPCR experiments. Relative gene expression was calculated using the comparative CT method known as 2ΔΔCt.
Abi 7500 platform
Manufactured by Thermo Fisher Scientific
Sourced in United States
The ABI 7500 platform is a real-time PCR system designed for quantitative gene expression analysis. It features a 96-well format, multiple fluorescent dye detection, and precision temperature control. The system provides reliable data for a range of research applications.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Primescript rt reagent kit, by Takara Bio (5 mentions)
Rneasy mini kit, by Qiagen (3 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (3 mentions)
Sybr green mix, by Takara Bio (3 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (2 mentions)
Iscript reverse transcription supermix, by Bio-Rad (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Revertra ace q polymerase chain reaction pcr rt kit, by Toyobo (2 mentions)
Primescript rt master mix, by Takara Bio (2 mentions)
Sds 1, by Thermo Fisher Scientific (2 mentions)
Rt human taqman microrna assay primers, by Thermo Fisher Scientific (2 mentions)
Veriti thermal cycler, by Thermo Fisher Scientific (2 mentions)
Taqman universal pcr master mix, by Thermo Fisher Scientific (2 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Sybr premix ex taq, by Takara Bio (2 mentions)
Nanodrop nd 1000, by Thermo Fisher Scientific (2 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Nanodrop 1000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Taqman microrna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
41 protocols using abi 7500 platform
1
Quantitative PCR Analysis of Gene Expression
2
Exosomal RNA Isolation and RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from exosomes or cells using the RNeasy Mini kit (Qiagen, Germany) following the manufacturer’s instructions. RNA quantify was determined using NanoDrop™ 2000/2000c Spectrophotometers (Thermo Fisher Scientific, USA). Then, the first-strand cDNA was synthesized using a reverse transcription PCR kit (Applied Biosystems, USA) according to the manufacturer’s instructions. RT-PCR was performed on the ABI7500 platform (Applied Biosystems, USA) according to the required conditions for each primer. Raw data were using the 2−ΔΔCt method22 (link) with β-actin as the reference gene.
3
Gene Expression Analysis of Chondrocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted from chondrocytes using an RNeasy Micro Kit from Qiagen (Qiagen, USA) following the manufacturer’s instructions. A Nanodrop spectrophotometer (Thermo Fisher Scientific, USA) was used to assess the quality and quantity of the extracted RNA. Then, 1 μg RNA was used to synthesize the corresponding cDNA using iScript™ Reverse Transcription Supermix (Bio-Rad Laboratories, USA) for RT-qPCR. SYBR-based real-time PCR was performed on the ABI7500 platform (Applied Biosystems, USA) to detect the total mRNA transcripts of human GPR40. The relative expression of GPR40 was normalized to that of GAPDH using the 2−∆∆ CT method and is presented as the fold-change. The following primers were used in this study: MMP-3: forward, 5ʹ-CCTCTATGGACCTCCCACAGAATC-3ʹ, reverse, 5ʹ-GGTGCTGACTGCATCGAAGGACAAA-3ʹ; MMP-13: forward, 5ʹ- CTGGCCTGCTGGCTCATGCTT-3ʹ, reverse, 5ʹ-CCTCAGAAAGAGCAGCATCGATATG-3ʹ; ADAMTS-4: forward, 5ʹ-ACACTGAGGACTGCCCAAC-3ʹ, reverse, 5ʹ-GGTGAGTTTGCACTGGTCCT-3ʹ; ADAMTS-5: forward, 5ʹ-GCAGAACATCGACCAACTCTACTC-3ʹ, reverse, 5ʹ-CCAGCAATGCCCACCGAAC-3ʹ; TNF-α, forward,5ʹ-GTCACTCATTGCTGAGCCTCT-3ʹ,reverse, 5ʹ-AGCTTCTTCCCACCCACAAG-3ʹ; IL-6, forward, 5ʹ-AGGGCTCTTCGGGAAATGTA-3ʹ, reverse,5ʹ-TGCCCAGTGGACAGGTTTC-3ʹ; GAPDH: forward, 5ʹ-ACTGGCGTCTTCACCACCAT-3ʹ; reverse, 5ʹ-AAGGCCATGCCAGTGAGCTT-3ʹ.
4
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from frozen tissue from tumors and cell lines using TRIzol (Invitrogen, USA) and reversely transcribed into cDNA using SuperScriptIII reverse transcriptase kit (Invitrogen, USA) in accordance to the manufacturer's instructions. The PCR amplification was performed using SYBR Premix Ex Taq™ II kit (Takara, Japan) on an ABI-7500 platform (Applied Biosystems, USA). GAPDH served as an internal standard. Experimental operation and reaction conditions referred to the description previously (Wang et al., 2014 (link)). The results are from three independent experiments performed in triplicate.
5
Validated qPCR Methods for GHB119 Cotton
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The inhibition runs for all materials and the qPCR for GHB119 cotton were performed following the validated methods (EURL GMFF, 2005 , 2007 , 2009 , 2012a , 2012b ) with an ABI 7900 platform (Life Technologies) or an ABI 7500 platform (Applied Biosystems).
6
FMDV O1 Manisa Nucleic Acid Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasma samples were evaluated with a real-time reverse transcriptase polymerase chain reaction (rRT-PCR) for FMDV O1 Manisa nucleic acid. RNA was extracted with the Applied Biosystems™ (Thermo Fisher) MagMAX™ Pathogen RNA/DNA Kit, and rRT-PCR was performed on an Applied Biosystems ABI 7500 platform using Applied Biosystems™ (Thermo Fisher) TaqMan™ Fast Virus 1-Step Master Mix with the following probes: (forward) 5′-ACTgggTTTTA CAAACCTgTga-3; (reverse) 5′gCgAgTCCTg CCACggA-3; and 6FAM-TCCTTTg CACgCCgTgggAC-Tamra. The presence of a Ct value < 40 was considered positive, while ≥40 was scored negative.
7
Quantitative Analysis of PVT1 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Using the University of California, Santa Cruz (UCSC) genome browser, we carefully annotated the PVT1 gene sequence and—exons were retrieved from the analysis. The Primer3 Plus software was used to custom-design primers for PVT1 exon 4A, exon 4B, and PVT1 exon 9. The qPCR assay was performed on an ABI 7500 platform (Applied Biosystems instruments, Grand Island, NY, USA)) with 25 μl reaction volumes containing 12.5 μl SYBR Green PCR master mix (Life Technologies, Grand Island, NY, USA cat# 4309155), 0.4 μM final concentration for primers, 2.5 μl cDNA template, and 7.5 μl of water. The thermal cycle protocol used was as follows: 50°C for 2 min, 10 min initial denaturation at 95°C, and 40 cycles of 15s denaturation at 94°C, 1 min annealing at 65°C. A dissociation curve was also added at the end of the cycle.
8
Quantitative PCR Assay for PVT1 Exons
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The quantitative PCR assay was performed on an ABI 7500 platform (Applied Biosystems instruments Grand Island, NY, USA). Primers for PVT1 exons 4A, 4B, and 9 were designed using Primer3Plus. The assay was performed as previously described (17 (link)). Concentration of PCR products were measured spectrophotometrically using NanoDrop® ND100 (Thermo Scientific NanoDrop Products, Wilmington, Delaware) in nanograms per microliter and converted to copies per microliter using the formula
9
Quantitative HBV DNA Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The assay was performed on an ABI 7500 platform (Applied Biosystems) with 30 μl reaction volumes containing 15 μl TaqMan® Universal Master Mix (Applied Biosystems), 3 μl HBVRO1 forward primer (5′-AGGAGGCTGTAGGCATAAATTGG 3′), 3 μl reverse primer (5′-GCACAGCTTGGAGGCTTG-3′), 0.6 μl probe (5′-FAM TCACCTCTGCCTAATC-3′-MGB, 6 μl extracted DNA and 2.4 μl of water.
10
MET Exon 14 Skipping Detection in Lung Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from paraffin-embedded lung cancer tissues using an FFPE DNA/RNA extraction kit (AmoyDx, Xiamen, China). The MET exon 14 skipping mutation was detected using the human lung cancer multi-gene mutation detection kit (fluorescence PCR method) (AmoyDx, Xiamen, China), which includes a probe covering a sequence connecting exons 13 and 15 splicing genes and exons. ARMS-PCR was conducted on an ABI 7500 platform (Applied Biosystems, MA, USA), and the running protocol was set up as follows: 5 min at 42°C and 5 min at 95°C; 25 s at 95°C, 20 s at 72°C for 10 cycles; 25 s at 93°C, 20 s at 72°C for 36 cycles; and maintained at 4°C. The FAM signal represents whether the MET gene in the sample RNA is amplified, and the HEX signal represents the MET gene expression. MET mutation was determined when the FAM signal Ct value ≤27 and △Ct value (FAM Ct - HEX Ct) ≤6. The quality control of ARMS-PCR method includes two parts: (1) FFPE samples within 2 years and the presence of tumor cells; and (2) the OD260/OD280 of the extracted RNA should be within 1.8–2.1, and the concentration of RNA should be 20–500 ng/μl.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!