Molpure trieasy plus total rna kit

Manufactured by Yeasen

Sourced in China

The MolPure® TRIeasy™ Plus Total RNA Kit is a lab equipment product designed for the efficient extraction and purification of total RNA from a variety of sample types. The kit utilizes a specialized reagent system to facilitate the lysis, phase separation, and precipitation steps necessary for RNA isolation.

Automatically generated - may contain errors

Lab products found in correlation

Hieff qpcr sybr green master mix, by Yeasen (3 mentions) Hifair advancefast 1st strand cdna synthesis kit, by Yeasen (2 mentions) Hifair 3 1st strand cdna synthesis supermix for qpcr, by Yeasen (2 mentions) Nanodrop, by Thermo Fisher Scientific (2 mentions) Hieff unicon universal blue qpcr sybr green master mix, by Yeasen (2 mentions) Real time pcr system, by Bio-Rad (1 mentions) Sybr premix ex taq, by Yeasen (1 mentions) Lightcycler 96, by Roche (1 mentions) Hifair 3 1st strand cdna synthesis kit, by Yeasen (1 mentions) Quantgene 9600, by Bioer (1 mentions) Rt reagent kit, by Vazyme (1 mentions) Quantstudio 5, by Thermo Fisher Scientific (1 mentions) Sybr premix, by Vazyme (1 mentions) Quantstudio 6, by Thermo Fisher Scientific (1 mentions) Hieff qpcr sybr green master mix kit, by Yeasen (1 mentions) Lightcycler 480 2 system, by Roche (1 mentions) Realstar power sybr qpcr mix, by GenStar (1 mentions) Hiscript 3 rt supermix, by Vazyme (1 mentions) Cfx96 real time pcr detection system, by Bio-Rad (1 mentions) Hifair 5 one step rt gdna digestion supermix for qpcr, by Yeasen (1 mentions)

13 protocols using molpure trieasy plus total rna kit

Quantitative mRNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total mRNA was isolated from the heart tissues using MolPure^® TRIeasy™ Plus Total RNA Kit (YEASEN, Shanghai, China), and cDNA was prepared using Hifair^® III 1st Strand cDNA Synthesis SuperMix for qPCR (YEASEN, Shanghai, China) according to the manufacturer’s instructions. The mRNA levels were assessed on a bio-rad cfx maestro system Real-time PCR system (Bio-Rad, USA) by qPCR using Hieff^® qPCR SYBR^® Green Master Mix (YEASEN, Shanghai, China). The relative expression of mRNA was calculated by △△Ct according to standard methods. The primer sequences as follows:
Cxcl2, forward: 5′-CCAACCACCAGGCTACAGG-3′, reverse: 5′-GCGTCACACTCAAGCTCTG-3′; Saa3, forward: 5′-TGCCATCATTCTTTGCATCTTGA-3′, reverse: 5′-CCGTGAACTTCTGAACAGCCT-3′; Smad1, forward: 5′-GGGGGATCCGTAATGTGACAAGTTTATTTTC-3′, reverse: 5′-TTTGCGGCCGCTCAAGATACAGATGAAATAG-3′; Arg1, forward: 5′-AGCTCTGGGAATCTGCATGG-3′, reverse: 5′-ATGTACACGATGTCTTTGGCAGATA-3′; GAPDH, forward: 5′-TGTGTCCGTCGTGGATCTGA-3′, reverse: 5′-CCTGCTTCACCACCTTCTTGA-3′.

Yuan J., Wang J.M., Li Z.W., Zhang C.S., Cheng B., Yang S.H., Liu B.T., Zhu L.J., Cai D.J, & Yu S.G. (2021). Full-length transcriptome analysis reveals the mechanism of acupuncture at PC6 improves cardiac function in myocardial ischemia model. Chinese Medicine, 16, 55.

+ Open protocol

+ Expand

GEMIN6 Expression Quantification by RT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNAs were extracted from cells with MolPure® TRIeasy Plus Total RNA Kit (Yeasen Biotechnology (Shanghai) Co. Ltd., China) and were reversed transcribed into cDNA using the Reverse Transcription Kit (CoWin Bioscience, China). For RT-PCR, the cDNA was amplified using SYBR Premix Ex Taq (Yeasen Biotechnology (Shanghai) Co. Ltd., China) and run on LightCycler® 96 (Roche, Germany). Relative mRNA expression was counted using the 2^−ΔΔCT method. The primer sequences of GEMIN6 and β-actin were listed: GEMIN6 forward: 5′-ATTTACAAAGAGGTCCGAGTGAC-3′, reverse 5′-AGCATGTCCCATAATTCCGGT-3′; β-actin forward: 5′-CATGTACGTTGCTATCCAGGC-3′, reverse 5′-CTCCTTAATGTCACGCACGAT-3′.

Peng Y., Wang Z., Cai J., Dong X, & Du Q. (2022). GEMIN6 Overexpression Correlates with the Low Immune Cell Infiltration and Poor Prognosis in Lung Adenocarcinoma. Journal of Oncology, 2022, 1930604.

+ Open protocol

+ Expand

Transcriptomic Analysis of Nicotiana benthamiana

Check if the same lab product or an alternative is used in the 5 most similar protocols

Conidia suspension of DSCF-02 and buffer (negative control) were infiltrated into healthy N. benthamiana leaves using a syringe without a needle. 24 h later, these leaves were harvested into liquid nitrogen. RNA sequencing of harvested samples was performed by Gene Denovo Biotechnology Co (Guangzhou, China). To perform RT-qPCR analysis, total RNA was extracted using MolPure® TRIeasy™ Plus Total RNA Kit (Yeasen, Shanghai, China), and cDNA synthesis was performed with Hifair® AdvanceFast 1st Strand cDNA Synthesis Kit (Yeasen, Shanghai, China). Assays were performed with SYBR Green Master Mix in a CFX96 Real-Time system. Relative expressions were calculated through the 2^-ΔΔCT method [71 (link)]. All primers used are listed in Table S4 (see online supplementary material).

Han M., Wang C., Zhu W., Pan Y., Huang L, & Nie J. (2024). Extracellular perception of multiple novel core effectors from the broad host-range pear anthracnose pathogen Colletotrichum fructicola in the nonhost Nicotiana benthamiana. Horticulture Research, 11(5), uhae078.

+ Open protocol

+ Expand

Intestinal Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from the intestinal tissues using MolPure^® TRIeasy Plus Total RNA Kit (Yeasen Biotechnology, Shanghai, China, 19211ES60) and reverse-transcribed to cDNA using the Hifair^® III 1st Strand cDNA Synthesis Kit (Yeasen Biotechnology, 11141ES60). Primer sequences were obtained from PrimerBank (https://pga.mgh.harvard.edu/primerbank/, accessed 20 August 2023) and synthesized at Sangon Biotech (Chengdu, China) (Supplementary Table S1). RT-PCR was performed using the Hieff^® qPCR SYBR Green Master Mix (No Rox, Yeasen Biotechnology, 11201ES03) on an QuantGene 9600 (Bioer Technology, Hangzhou, China). PCR amplification was conducted in triplicate for each sample, and the expression of target genes was normalized to β-actin. Relative expression was determined using the 2^−ΔΔCt method.

Wang J.M., Yang J., Xia W.Y., Wang Y.M., Zhu Y.B., Huang Q., Feng T., Xie L.S., Li S.H., Liu S.Q., Yu S.G, & Wu Q.F. (2023). Comprehensive Analysis of PANoptosis-Related Gene Signature of Ulcerative Colitis. International Journal of Molecular Sciences, 25(1), 348.

+ Open protocol

+ Expand

Quantitative RT-PCR of Gapdh and Chi3l1

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using MolPure® TRIeasy Plus Total RNA Kit (Catalog No. 19211ES60, YEASEN, China). RNA concentration was measured by Nanodrop (Thermo ScientificTM, USA), and each paired sample was adjusted to the same concentration. For reverse transcription (RT), we used an RT reagent kit purchased from Vazyme (Catalog No. R323-01, China). Real-time PCR was subsequently performed using SYBR Premix supplied by Vazyme (Catalog No. Q711-02, China) on the Applied Biosystems Quantstudio 5 and Quantstudio 6 Flex (Thermo Fisher, USA). The primers were synthesized by Tsingke (China), and the following primer sequences were used:
Gapdh-F: 5′- AGGTCGGTGTGAACGGATTTG -3’
Gapdh-R: 5′- TATGGTTTTGACGACTGTGTGAT -3’
Chi3l1-F: 5′- CTGCGTACAAGCTGGTCTG -3’
Chi3l1-R: 5′- TGGATGGCGTCTGGTAAGAAG -3’

Lu D., Lin Z., Wang R., Chen Z., Zhuo J., Xu L., Pan L., Li H., Yang X., He C., Shen W., Yang M., Li H., Chen H., Tan W., Wei X., Zheng S, & Xu X. (2022). Multi-omics profiling reveals Chitinase-3-like protein 1 as a key mediator in the crosstalk between sarcopenia and liver cancer. Redox Biology, 58, 102538.

+ Open protocol

+ Expand

Validation of RNA-seq Differential Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

cDNA from the cell samples was obtained using MolPure^® TRIeasy™ Plus Total RNA Kit and Hifair^® AdvanceFast 1st Strand cDNA Synthesis Kit according to the manufacturer’s protocols (Yeasen Biotechnology Co., Ltd., Shanghai, China). Twelve differentially expressed genes in the RNA-seq data were subjected to qRT-PCR to validate their expression patterns, and a ubiquitin C gene was used as the internal reference gene. Their primers for qRT-PCR were designed using NCBI Primer-BLAST (https://www.ncbi.nlm.nih.gov/, accessed on 8 October 2023) and are listed in Table S2. qRT-PCR was performed with three replicates on a StepOnePlus™ Real-Time PCR System (ABI, Foster City, CA, USA) using a Hieff^® qPCR SYBR Green Master Mix Kit (Yeasen Biotechnology Co., Ltd., Shanghai, China). The relative expression levels of genes were calculated using the 2^−ΔΔCT method and then normalized.

Liu Z., Zhu X., Mohsin A., Sun H., Du L., Yin Z., Zhuang Y, & Guo M. (2024). Uncovering the Role of Hydroxycinnamoyl Transferase in Boosting Chlorogenic Acid Accumulation in Carthamus tinctorius Cells under Methyl Jasmonate Elicitation. International Journal of Molecular Sciences, 25(5), 2710.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from frozen lung tissue using MolPure^® TRIeasy™ Plus Total RNA Kit (Yeasen Biotechnology, Shanghai, China). For cDNA synthesis, 2 μg of total RNA was reverse-transcribed into cDNA using TOROIVD^® qRT Master Mix (Toroivd, Shanghai, China) according to the supplier’s instruction. For real-time PCR, reactions were performed on the Roche LightCycler 480 II system (Roche Diagnostics GmbH, Mannheim, Germany) using SYBR Green PCR Master Mix Plus (Vazyme, Nanjing, China), according to the manufacturer’s instructions. Amplification of ACTB and GAPDH mRNA was performed on each sample as a control for normalization. The relative expression of the target genes was also corrected to ACTB and GAPDH using 2^−ΔCT method. The primer sets used were described previously [32 (link)].

Ye L., Liu R., Li Q., Zhou C, & Tan X. (2024). Dysregulated VEGF/VEGFR-2 Signaling and Plexogenic Lesions in the Embryonic Lungs of Chickens Predisposed to Pulmonary Arterial Hypertension. International Journal of Molecular Sciences, 25(8), 4489.

+ Open protocol

+ Expand

qPCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

For qPCR analysis, total RNA was extracted using the MolPure^® TRIeasy™ Plus Total RNA Kit (19211ES60, Yeasen, Shanghai, China), following the manufacturer’s instructions. RNA samples (1 µg) were reverse transcribed using HiScript III-RT SuperMix (R323-01, Vazyme, Nanjing, China) to generate cDNA. qPCR was performed using 2 × RealStar Power SYBR qPCR Mix (A313-01, GenStar, Beijing, China) on a RT-PCR system (CFX96 Real-Time PCR Detection System, Bio-Rad, Harales, CA, USA) using β-actin as a housekeeping gene. Relative changes in gene expression were calculated by the 2^−∆∆Ct method. All primer sequences are presented in Table S1.

Jiang X., Yang Q., Qu H., Chen Y, & Zhu S. (2023). Endogenous n-3 PUFAs Improve Non-Alcoholic Fatty Liver Disease through FFAR4-Mediated Gut–Liver Crosstalk. Nutrients, 15(3), 586.

+ Open protocol

+ Expand

Profiling Cold-Responsive Genes in Cucurbitaceae

Check if the same lab product or an alternative is used in the 5 most similar protocols

Differentially expressed genes (DEGs) between XIS49 and CL on the identified QTL LTT6.1 were primarily determined based on RNA-seq reads (downloaded from NCBI under BioProject ID PRJNA817708). And quantitative real-time PCR (qRT-PCR) was carried out to further profile their response during the cold treatment. The leaf samples were collected at 0 h, 8 h, 16 h, 24 h, and 32 h in the cold treatment. The total RNA was extracted using the MolPure TRIeasy Plus Total RNA Kit (Yeasen Biotechnology, Shanghai, China). Reverse transcription was performed using Hifair V one-step RT-gDNA digestion SuperMix for qPCR (Yeasen Biotechnology, Shanghai, China). For the qRT-PCR, the PCR reagent was SYBR Prime qPCR Kit (Fast HS) (BioGround Biotechnology, Chongqing, China), and the apparatus was the Bio-Rad CFX96 (Bio-Rad, Hercules, CA, USA). The inner reference gene was ubiquitin (Gene ID: CsaV3_7G003730). All the primers are listed in Table S1.

Zhang R.J., Liu B., Song S.S., Salah R., Song C.J., Xia S.W., Hao Q., Liu Y.J., Li Y, & Lai Y.S. (2023). Lipid-Related Domestication Accounts for the Extreme Cold Sensitivity of Semiwild and Tropic Xishuangbanna Cucumber (Cucumis sativus L. var. xishuangbannanesis). International Journal of Molecular Sciences, 25(1), 79.

+ Open protocol

+ Expand

Quantifying γ-PGA Synthase Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

After fermentation for 24 h, the C. glutamicum cells
B M C M A H , and B M C M A L ) were harvested by centrifugation, and the transcription levels of γ-PGA synthase components (CapB, CapC, and CapA) were quanti ed by qRT-PCR. The total RNA of the strains was extracted using MolPure® TRIeasy Plus Total RNA Kit (YEASEN, Shanghai, China) according to the manufacturer's instructions, and utilized to synthesize cDNA with Hifair® 1st Strand cDNA Synthesis SuperMix (YEASEN, Shanghai, China). qRT-PCR was performed using Universal Blue qPCR SYBR Green Master Mix (YEASEN, Shanghai, China), and the primers for ampli cation were designed by utilizing Beacon designer (Additional le 1: Table S2). The 16S rRNA gene was chosen as an internal reference gene to evaluate the relative expression level of the samples. All the experiments were performed in triplicate.
ANOVA model explain the contribution of CapB, CapC, and CapA to the synthesis of γ-PGA, we analyzed these factors by ANOVA. The linear model was as follows:
where yield ijk is the γ-PGA yield obtained under the expression intensity of a single regulatory monomer

Xu G., Wang J., Gu L., Zhu Y., Zha J., Zhang X., Zhang X., Cheng Z., Yuan Z., Cui W., Shi J., Koffas M.A.G., & Xu Z. (2021). Functional Caracterization of CapBCA in Controlling Poly-γ-Glutamic Acid Synthesis in Corynebacterium Glutamicum.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!