Cw0103

The proteins from cell samples were harvested using RIPA (Radio-Immune Precipitation Assay) lysis buffer (Beyotime, Nanjing, China) and quantified by bicinchoninic acid protein assay kit (Beyotime Biotechnology, Shanghai, China). Western blotting (WB) was performed by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis as previously described (Xiao et al., 2017 (link)). Primary antibodies specific to GADD45B (1:500; YN1622; Immunoway; Beijing, China), P38 (1:1,000; 8690S; CST, Danvers, MA, United States), p-p38 (1:1,000; 4511S; CST, Danvers, MA, United States), and GAPDH (1:1,000; 97166S; CST, Danvers, MA, United States) were used. The membranes were then incubated with antirabbit (cw0103s, 1:5,000; Cwbiotech, Beijing, China) or anti-mouse (cw0102s, 1:5,000; Cwbiotech) secondary antibody for 1 h at room temperature. We detected protein band signals by using Immobilon Western Chemiluminescent HRP Substrate (WBKLS0500, Darmstadt, Germany).

Total protein was isolated from cells by using lysis buffer (P0013B; Beyotime, China). For high-throughput protein detection, we cut the membrane corresponding to the protein molecular weight prior to incubation with antibodies. Immunoblotting was performed with primary antibodies against MUC1 (sc-7313; Santa Cruz, USA; 1:200), ITGA2 (ab133557; Abcam, USA; 1:500), ITGA3 (ab131055; Abcam, USA; 1:500), ERK1/2 (4695; CST, USA; 1:1000), phosphorylated ERK1/2 (Thr202/Tyr204) (4370; CST, USA; 1:500) and GAPDH (60004-1-Ig; Proteintech, China; 1:5000) as the control and followed by the secondary antibodies (CW0102S and CW0103S; CWbiotech, China; 1:5000). The specific bands were visualized with super enhanced chemiluminescence (ECL) detection reagent (180–5001; Tanon, China).

The tissues were fixed with 4% paraformaldehyde for 24-48 h. The tissue was dehydrated and transparent with gradient ethanol and xylene, and then immersed in wax for 3 hours before embedding. After drying and fixing into blocks, tissue slices with a thickness of 0.5 μm were prepared. Collect several tissue slices, and use gradient ethanol and xylene to dehydrate and transparent. The tissue slices were stained with hematoxylin and eosin and then sealed with neutral gum. The adipose slices were detected by immunohistochemistry with anti-UCP1 (1:50, Proteintech, 23673-1-AP, Rabbit) and -PGC1α (1:50, Proteintech, 66369-1-1g, Mouse) antibodies. The secondary anti-Mouse (1:150, CWBIO, CW0102S, China) and anti-rabbit (1:150, CWBIO, CW0103S, China) for 1 h at 37°C. After mounting the slides with neutral gum, observe the sections through a confocal microscope (Olympus, FV1000, Japan).

Cells were collected at each time point, and cell lysates were prepared as described. Western blots were performed with the following antibodies: antibody to caspase‐3 (1:2500, ab32351, Abcam, US), cIAP1 (1:1000, ab154525, Abcam, US), cIAP2 (1:1000, ab32059, Abcam, US), β‐actin (1:5000, CW0096M, CWBIO, China), Goat Anti‐Mouse IgG, HRP Conjugated (1:5000, CW0102S, CWBIO, China), Goat Anti‐Rabbit IgG, HRP Conjugated (1:5000, CW0103S, CWBIO, China).
Cell RNA was extracted by Trizol^® (ambion, life, America) as described. mRNA expression levels were detected using the EvaGreen kit (abm, America) with 40 cycles. The program was set according to the manufacturer's standard protocol. Results were analysed with the 2^−ΔΔCt method. The GAPDH was used as the house‐keeping gene in all PCR experiments. Primers: cIAP1 (Forward) 5′‐TTGTCAACTTCAGATACCACTGGAG‐3′; (Reverse) 5′‐CAAGGCAGATTTAACCACAGGTG‐3′; cIAP2 (Forward) 5′‐TCCTGGATAGTCTACTAACTGCC‐3′; (Reverse)5′‐GCTTCTTGCAGAGAGTTTCTGAA‐3′.

The lung tissues of mice were homogenized and lysed for 30 min in ice-cold RIPA buffer (Beyotime, Shanghai, China) with 1% PMSF (Beyotime, Shanghai, China). Then, the lysates were centrifuged at 16,000 ×g for 15 min at 4 °C. The supernatant was collected and quantified. Total proteins (20 μg) were resolved by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to nitrocellulose (NC) membranes. The membrane was blocked in Tris-buffered saline tween-20 (TBST, 8 g/L NaCl, 2.42 g/L Tris-base, 0.1% Tween 20) with 5% (wt/vol) powdered milk for 90 min and then incubated with primary antibodies (1:1000 dilution) at 4 °C overnight. After 3 washes with TBST, the proteins were blotted with horseradish peroxidase (HRP)-goat anti-rabbit IgG (CW0103S, CWBIO, Beijing, China) or HRP-goat anti-mouse IgG (EO32210-02, EARTHOX, Burlingame, CA, USA). The signal was detected by an ECL plus kit (Yeasen, Shanghai, China) and analyzed with Image Lab 3.0 (Bio-Rad, Hercules, CA, USA) according to the manufacturer’s protocol. β-Actin was used as an internal control.