Taqman probe 5 6 carboxyfluorescein fam cgcatacagacttccgcccagt 6 carboxytetramethylrhodamine tamra 3

Right brain halves and whole spinal cords from three to five mice per group per time point were placed in Lysing Matrix D tubes and homogenized in 1.0 mL Qiazol at 6.0 M/s for 40 sec in a FastPrep-24 homogenizer (MP Biomedicals). RNA was isolated using the Qiagen RNeasy Lipid Mini kit and cDNA was synthesized with random primers using a Life Technologies High Capacity cDNA Reverse Transcription Kit. qRT-PCR was performed using TaqMan Universal PCR Master Mix (Roche) on a 7500 Fast Real-Time PCR System for 50 cycles, and results were analyzed using Sequence Detector software, version 1.4. Ifng mRNA was measured using a commercially available TaqMan gene expression assay (Integrated DNA Technologies), and relative gene expression versus mock-infected mice was determined by the ΔΔCT method using mouse Gapdh for normalization. SINV RNA copies were measured using TaqMan probe (5′–6-carboxyfluorescein [FAM]-CGCATACAGACTTCCGCCCAGT-6-carboxytetramethylrhodamine [TAMRA]-3′ (Applied Biosystems) and primers to the SINV E2 gene (forward, 5′-TGGGACGAAGCGGACGATAA-3′; reverse, 5′-CTGCTCCGCTTTGGTCGTAT-3′). SINV E2 copies were quantified using a standard curve made of ten-fold dilutions of a plasmid containing the SINV subgenomic region and normalized to endogenous mouse Gapdh.