Standard DNA for Vibrio-targeting qPCR originated from an in house culture of V. aestuarianus and was extracted using the QIAGEN® QIAamp® DNA Mini Kit. A 114 bp long DNA fragment was amplified using the primer pair 567F (GGCGTAAAGCGCATGCAGGT) and 680R (GAAATTCTACCCCCCTCTACAG) (Thompson et al., 2004 (link)), applying an annealing temperature of 60.2°C. Cloning of the purified PCR products into the vector took place with the StrataClone Blunt PCR Cloning Kit (Agilent Technologies, USA) and extraction of the vector from colonies with the QIAGEN® Plasmid Mini Kit (QIAGEN, DE). The samples were analyzed in three qPCR runs, each run including three standard samples. The mean values of the run conditions are listed in the following: slope = 3.155 ± 0.062, PCR efficiency = 107.53 ± 2.97, γ intercept = 45.609 ± 1.440, R2 = 0.998±0.002, Ct cut-off = 30.7.
Strataclone blunt pcr cloning kit
Manufactured by Agilent Technologies
Sourced in United States
The StrataClone Blunt PCR Cloning Kit is a molecular biology tool designed for the efficient cloning of blunt-ended PCR products. It provides a fast and reliable method for the direct insertion of PCR amplicons into a vector without the need for enzymatic modification of the DNA fragments.
Automatically generated - may contain errors
Lab products found in correlation
Q5 site directed mutagenesis kit, by New England Biolabs (2 mentions)
Qiaamp dna mini kit, by Qiagen (1 mentions)
Plasmid mini kit, by Qiagen (1 mentions)
Hiseq 2500 system, by Illumina (1 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Truseq small rna sample preparation kit, by Illumina (1 mentions)
Phusion high fidelity dna polymerase, by New England Biolabs (1 mentions)
Pgl4.10 luc2 vector, by Promega (1 mentions)
Qiaquick gel extraction kit, by Qiagen (1 mentions)
Transit lt1 transfection reagent, by Mirus Bio (1 mentions)
Peyfp n1, by Takara Bio (1 mentions)
Nunc lab tek permanox chamber slides, by Thermo Fisher Scientific (1 mentions)
Cytation 5 plate reader, by Agilent Technologies (1 mentions)
Dual luciferase assay kit, by Promega (1 mentions)
Q5 high fidelity dna polymerase, by New England Biolabs (1 mentions)
Pgl3 promoter, by Promega (1 mentions)
Gene pulser 2, by Bio-Rad (1 mentions)
Quick ligation kit, by New England Biolabs (1 mentions)
Affinityscript cdna synthesis kit, by Agilent Technologies (1 mentions)
Quickchange 2 xl site directed mutagenesis kit, by Agilent Technologies (1 mentions)
18 protocols using strataclone blunt pcr cloning kit
1
Quantification of Vibrio aestuarianus by qPCR
2
Radiolabeling of U1 snRNA Antisense
3
Small RNA Sequencing Library Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA amplification was performed using the TruSeq Small RNA Sample Preparation Kit (Illumina) according to the manufacturer's protocol. Briefly, 6 μl of ligated RNA and 1 μl of RTP primer were incubated at 70°C for 2 min and then placed on ice. Reverse transcription was subsequently performed by adding 5.5 μl of a RT reaction mixture comprising 2 μl of 5× First Strand Buffer, 0.5 μl of 12.5 mM each dNTP, 1 μl of 100 mM dithiothreitol, 1 μl of RNase inhibitor and 1 μl of SuperScript III Reverse Transcriptase (Life Technologies), followed by incubation at 55°C for 60 min. The resultant cDNAs were amplified by polymerase chain reaction (PCR) (11 cycles) using a PCR enzyme mix (PML) and primers included in the Illumina kit. PCR products were developed using 8% native polyacrylamide gel electrophoresis (PAGE), and mature tRNA amplified regions were gel-purified. To confirm the amplified cDNA sequences, purified cDNAs were cloned using StrataClone Blunt PCR Cloning Kit (Agilent Technologies). The cDNAs were further sequenced (100 nt single-read) on an Illumina HiSeq 2500 system after PhiX library clustering by the Next-Generation Sequencing Core at University of Pennsylvania.
4
Cercozoa-Specific 18S Gene Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The amplification of 18S gene fragment was conducted with a modified version of reverse primer 1256R of Bass and Cavalier‐Smith (2004 ) (1256R_mod: 5′‐RDRATYAAGAAAGADCTTCAA‐3′) and a newly developed forward primer 48F_Cerco (5′‐GCCATGCAWGTCTAAGWATA‐3′). These primers were designed to specifically amplify Cercozoa and to exclude other groups of organisms, especially plants and fungi. However, due to the large diversity within this group, it was not possible to design a primer that amplified all known cercozoan genera.
Polymerase chain reaction (PCR) was conducted using Phusion High Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA). The PCR reaction contained 1× Phusion GC Buffer, 200 μM dNTPs, 0.8 mg/ml BSA, 3% DMSO, 0.5 μM forward and reverse primer, 0.5 units polymerase, and 10 ng DNA (PCR conditions in Table1 ). PCR reactions were conducted for the 16 individual plant‐leaf samples per species by location combination separately and pooled before cloning. The cloning reaction was conducted with StrataClone Blunt PCR Cloning Kit (Agilent Technologies, Santa Clara, CA) following the manufacturer's instructions. Clones were picked, inserts amplified with PCR primers under same conditions as described above, and PCR products were sequenced at the Labcenter of BiK‐F (Biodiversity and Climate Research Center, Frankfurt (Main), Germany).
Polymerase chain reaction (PCR) was conducted using Phusion High Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA). The PCR reaction contained 1× Phusion GC Buffer, 200 μM dNTPs, 0.8 mg/ml BSA, 3% DMSO, 0.5 μM forward and reverse primer, 0.5 units polymerase, and 10 ng DNA (PCR conditions in Table
5
Murine IL-6 Promoter Analysis and Vav1 Constructs
6
Cloning and Expressing REEP6 Splice Variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The REEP6 splice variant open reading frames were amplified from control D124 optic cup cDNA16 (link) using the primers REEP6_F1, 5′-GCTAGCCACCATGGACGGCCTGAGGCAGCGCGTGGAG-3′, and REEP6_R1stop, 5′-AATCTAGAGCGGCCGCTCACTTGTCCTTCGGCTGCGGGGTCTGGC-3′. The two observed PCR amplicons corresponded to the predicted REEP6.1 and REEP6.2 sizes and were excised and gel purified (QIAquick Gel Extraction Kit, QIAGEN) prior to cloning into the pSC-B-amp/kan vector (StrataClone Blunt PCR Cloning Kit, Agilent Technologies). Clone identities (REEP6.1, GenBank: NM_001329556.1 ; REEP6.2, GenBank: NM_138393.2 ) were confirmed by Sanger sequencing (Source BioScience). Mutations were introduced by site-directed mutagenesis (Q5 Site-Directed Mutagenesis Kit, New England Biolabs) using primers and conditions specified by the NEBaseChanger software. Sequence integrity was confirmed by Sanger sequencing as before. To create expression vectors, wild-type (WT) and mutant REEP6.1 sequences were cloned into pEYFP-N1 (Clontech) digested with BmtI and NotI to release the EYFP sequence. WT and mutant REEP6.1 expression plasmids were transfected into SK-N-SH (ATCC) cells using TransIT-LT1 Transfection Reagent (Mirus Bio) using the manufacturers’ recommended conditions, in 8-well Nunc Lab-Tek Permanox chamber slides (ThermoFisher Scientific) plated at 40,000 cells/well and 6-well plates plated at 500,000 cells/well.
7
Characterization of Bach2 Regulatory Region
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bach2 region of interest 1 (ROI 1) was PCR amplified from murine genomic DNA using Q5 high-fidelity DNA polymerase (New England Biolabs, Ipswich, MA, United States). PCR products were cloned using the StrataClone Blunt PCR cloning kit (Agilent Technologies, La Jolla, CA, United States). ROI 1 was ligated in the forward orientation into the KpnI/SacI sites of the luciferase reporter pGL3-promoter (Promega, Madison, WI, United States) and confirmed by sequencing. Mutation of the predicted ROI 1 ETS site (GGAA → GGCC) was performed using the Q5 site directed mutagenesis kit (New England Biolabs). pRL-TK (Renilla luciferase), pGL3-basic, pGL3-promoter, pGL3-promoter-ROI 1, and pGL3-promoter ROI 1 mutant vectors were transfected into 4 × 106 WEHI-279 cells by electroporation using a Gene Pulser II with capacitance extender at 220V and 950 mF (Bio-Rad, Mississauga, ON, United States). Luciferase activity was measured 24 h after transfection using the Dual Luciferase Assay Kit (Promega). Luminescence was determined using a Cytation 5 plate reader (BioTek, Winooski, VT, United States).
8
cDNA Synthesis and Cloning from OT-I CTL
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA was synthesized using oligo dT primers from RNA isolated from 5x106 OT-I CTL (3-5 days post-activation) with the RNA mini (QIAGEN) and AffinityScript cDNA synthesis kits (Agilent technologies). PCR amplifications were carried out using AccuPrime Pfx DNA polymerase kits in a G-storm thermal cycler system 482 (G-storm Ltd, Labtech International). Site-directed mutagenesis used the QuickChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies); ligations, the Quick ligation kit (New England Biolabs). Synthesized double stranded DNA were designed then manufactured by Integrated DNA Technologies (gBlocks; IDT, Iowa, USA) and cloned into pSC-B carrier plasmids using the StrataClone Blunt PCR Cloning Kit (Agilent Technologies).
9
Genomic DNA Amplification and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was prepared using Zymo gDNA columns (Zymo Research), and specific regions were amplified by PCR using primers listed in Table S1 using Q5 mastermix (New England Biolabs). PCR fragments were cloned using the StrataClone Blunt PCR cloning kit (Agilent). Sequencing was performed by GenScript. ATM mutations were compared with annotations in the LOVD database (http://atm.lovd.nl ). TCRβ junction sequences were identified by amplification with the Jβ1 family of primers and the Vβ pan primer from Assaf et al. (2000) (link). Amplified fragments were cloned into the Stratagene Blunt PCR cloning kit (Agilent) and sequenced with an M13R vector-specific primer.
10
Sequencing and Analysis of Switch Regions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated and recombined Sμ-Sα sequences were amplified by PCR (35 cycles of 98°C 10 s, 68°C 2 min 30 s) using high fidelity PrimeSTAR HS DNA Polymerase (Tanaka) (see Table S4 for primer sequences). PCR products spanning 1–2 kb were gel-extracted with QiaexII gel extraction kit (QIAGEN) and cloned using StrataClone Blunt PCR cloning kit (Agilent). DNA from individual clones was sequenced with T7 and T3 primers and NCBI blast was used for sequence alignment with germline switch sequences (obtained from Genome Reference Consortium Mouse Build 38). Sμ sequences were analyzed for mutation frequency as the number of individual mutations at each nucleotide out of the total number of nucleotides analyzed per experiment. The length of microhomology (MH) at Sμ–Sα junctions was measured as the number of consecutive nucleotides with perfect homology. Insertions were defined as nucleotides at the breakpoints with no homology to either of the S-regions. Only Sμ–Sα sequences with a unique pattern of Sμ mutation were considered for these analyses.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!