Tgf β1

Approximately 1 × 10⁵ U87-EGFRvIII cells during the exponential phase were plated on each well in a 12-well plate (1000 μL/well) to ensure that the cell confluence reached 60–90% at the second day. Then, 2 μl Lipofectamine 2000 transfection reagent (Invitrogen, USA) and 2 μl miR-326 mimics or TGF-β1 siRNA (GenePharma, China) were added into separate tubes with 50 μL DMEM for 5 min; then, they were mixed together for 15–20 min. Next, the mixture was added directly to cells in culture medium in the presence of serum but no antibiotics. At 4 to 6 h after transfection, medium was removed and replaced with fresh media, and the culture was continued for an additional 42–68 h. The human TGF-β1 specific-siRNA sequences GATCCCCGACTATCGACATGGAGCTGttcaagagaCAG CTCCATGTCGATAGTCTTTTTGGAAA and TCGATTT CCAAAAAGACTATCGACATGGAGCTGtctcttgaaCAG CTCCATGTCGATAGTCGGG were cloned into the pGPU6/GFP/Neo vector (GenePharma). Photographs of the transfected cells were taken at 0 h and after 24 h using an Axiovert 200 microscope (Carl Zeiss) before CCK-8 assay. The fluorescence was captured in six different photographs.

The HK2 cells were cultured in the Dulbecco’s modified Eagle medium (DMEM)/F12 (Corning, USA) supplemented with 5% fetal bovine serum. After reaching 50% confluency, the cells were synchronized in serum-free DMEM/F12 for 18 h and then stimulated with TGF-β1 at 6, 8, and 10 ng/mL concentrations for 24, 48, and 72 h. miR-133b mimic and miRNA mimic control (GenePharma, China) were transfected into HK2 cells for 6 h using the jetPRIME® transfection reagent according to the manufacturer’s instructions (Polyplus-transfection, France). Following transfection, the cells were cultured in DMEM/F12 with 5% serum for 18 h and then incubated with DMEM/F12 with 5% serum and 8 ng/mL of TGF-β1 (PeproTech, USA) for 48 h.