Log In Sign up
The largest database of trusted experimental protocols

Kapa hifi master mix

Manufactured by Roche
Visit Supplier
Sourced in United States

KAPA HiFi Master Mix is a high-fidelity, hot-start DNA polymerase-based reagent designed for PCR amplification. It provides efficient and reliable DNA amplification with high accuracy and yield.

Automatically generated - may contain errors

Lab products found in correlation

Jumpstart accutaq la dna polymerase, by Merck Group (2 mentions) Kapa hyper library prep kit, by Roche (1 mentions) Le220, by Covaris (1 mentions) Novaseq 6000, by Illumina (1 mentions) Kapa library quantification kit, by Roche (1 mentions) Optiprep density gradient medium, by Merck Group (1 mentions) Ampure xp magnetic beads, by Beckman Coulter (1 mentions) 2100 bioanalyzer high sensitivity dna chip, by Agilent Technologies (1 mentions) Proteinase k, by New England Biolabs (1 mentions) Bsphi, by New England Biolabs (1 mentions) Agilent 2100 bioanalyzer, by Agilent Technologies (1 mentions) Ampure xp bead, by Beckman Coulter (1 mentions) Dnase, by New England Biolabs (1 mentions) Accuprime taq dna polymerase, by Thermo Fisher Scientific (1 mentions) Sybr safe dna gel stain, by Thermo Fisher Scientific (1 mentions) Qiaamp dna stool mini kit, by Qiagen (1 mentions) Nanodrop nd 1000, by Thermo Fisher Scientific (1 mentions) Qiaamp fast dna stool mini kit, by Qiagen (1 mentions) Mastercycler pro s, by Eppendorf (1 mentions) 2100 bioanalyzer, by Agilent Technologies (1 mentions)

Close spelling variants of this product

KAPA HiFi (30 citations) 2x KAPA HiFi mix (6 citations) KAPA HiFi HotStart master mix (4 citations) KAPA HIFI Master Mix 2× (4 citations) KAPA HiFi HotStart Real-time PCR 2X Master Mix (3 citations) Kapa HiFi 2X master mix (3 citations) KAPA HiFi HotStart DNA Polymerase with 2X Master Mix (3 citations)

17 protocols using kapa hifi master mix

1

Low-biomass DNA extraction and library prep

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Lysates were prepared as above. All reagents were sterilized, vacuum filtered, and autoclaved prior to use. DNA was purified using Purelink gDNA extraction kits (Thermo, #K182104A) as they improved yield in these low-biomass samples. The only modification to the Purelink protocol was elution of DNA into 10μL of sterile water three consecutive times, incubating the plate for 2 minutes at 37°C each time. DNA libraries were prepared using HackFlex (38 (link)) with the following modifications: (1) the tagmentation was scaled to start with 10μL of DNA; (2) the tagmentation-stop step was skipped; (3) we used standard Illumina barcodes for plates MG1-3 and UDI primers (20091660) for plates MG4-7 (Supplemental table 3); (4) we used KAPA HiFi master mix (Roche, 07958935001) and 19 cycles of PCR.
Baker J.S., Qu E., Mancuso C.P., Tripp A.D., Conwill A, & Lieberman T.D. (2024). Highly-resolved within-species dynamics in the human facial skin microbiome. bioRxiv.
+ Open protocol
+ Expand
2

Targeted Exome Sequencing for Genomic Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
First, 100–250 ng of genomic DNA was fragmented on the Covaris LE220 instrument targeting 250-base pair (bp) inserts. Automated dual-indexed libraries were constructed with the KAPA Hyper library prep kit (Roche) on the SciClone NGS platform (Perkin Elmer). Up to ten libraries were pooled at an equimolar ratio by mass before the hybrid capture targeting a 5-µg library pool. The library pools were hybridized with the xGen Exome Research Panel v1.0 reagent (IDT Technologies) that spans a 39-megabase (Mb) target region (19,396 genes) of the human genome. The libraries were hybridized for 16–18 h at 65 °C followed by stringent washing to remove spuriously hybridized library fragments. Enriched library fragments were eluted and PCR cycle optimization was performed to prevent over amplification. The enriched libraries were amplified with KAPA HiFi master mix (Roche) before sequencing. The concentration of each captured library pool was accurately determined through quantitative PCR (qPCR) utilizing the KAPA Library Quantification Kit according to the manufacturer’s protocol (Roche) to produce cluster counts appropriate for the Illumina NovaSeq-6000 instrument. Then, 2 × 150 paired-end reads were generated targeting 12 gigabases of sequence to achieve ~100x coverage per library.
Cui Zhou D., Jayasinghe R.G., Chen S., Herndon J.M., Iglesia M.D., Navale P., Wendl M.C., Caravan W., Sato K., Storrs E., Mo C.K., Liu J., Southard-Smith A.N., Wu Y., Naser Al Deen N., Baer J.M., Fulton R.S., Wyczalkowski M.A., Liu R., Fronick C.C., Fulton L.A., Shinkle A., Thammavong L., Zhu H., Sun H., Wang L.B., Li Y., Zuo C., McMichael J.F., Davies S.R., Appelbaum E.L., Robbins K.J., Chasnoff S.E., Yang X., Reeb A.N., Oh C., Serasanambati M., Lal P., Varghese R., Mashl J.R., Ponce J., Terekhanova N.V., Yao L., Wang F., Chen L., Schnaubelt M., Lu R.J., Schwarz J.K., Puram S.V., Kim A.H., Song S.K., Shoghi K.I., Lau K.S., Ju T., Chen K., Chatterjee D., Hawkins W.G., Zhang H., Achilefu S., Chheda M.G., Oh S.T., Gillanders W.E., Chen F., DeNardo D.G., Fields R.C, & Ding L. (2022). Spatially restricted drivers and transitional cell populations cooperate with the microenvironment in untreated and chemo-resistant pancreatic cancer. Nature Genetics, 54(9), 1390-1405.
+ Open protocol
+ Expand
3

Single-Cell Sequencing of HIV-Infected Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were mixed at a 1:100 JLat:3T3 ratio and resuspended in HBSS containing 18% OptiPrep density gradient medium (Sigma-Aldrich) for microfluidic encapsulation. Mouse–human mixing studies used agarose conjugated with acrydite-T5-SMART-T30VN and the Smart-seq2 TSO (AAGCAGTGGTATCAACGCAGAGTACATrGrGrG) for reverse transcription. The digital droplet genomic PCR was performed using 900 nM HIV gag forward primer (CACTGTGTTTAGCATGGTGTTT), 900 nM HIV gag reverse primer (TCAGCCCAGAAGTAATACCCATGT) and 250 nM HIV gag TaqMan probe (CY5-ATTATCAGAAGGAGCCACCCCACAAGA-3′ Iowa Black RQ). Drops were thermocycled under the following conditions: 88 °C for 10 min, then 55 cycles of (88 °C for 15 s and 60 °C for 1 min) and sorted into single wells. PCR strip tubes were frozen at −80 °C for at least 2 h and 50 μl WTA reactions were set up with a final concentration of 1× KAPA HiFi master mix (Roche, KK2601) and 0.4 μM Smart-seq2 primer (AAGCAGTGGTATCAACGCAGAGT). Library preparation was performed as described in the scFIND-seq section.
Clark I.C., Wheeler M.A., Lee H.G., Li Z., Sanmarco L.M., Thaploo S., Polonio C.M., Shin S.W., Scalisi G., Henry A.R., Rone J.M., Giovannoni F., Charabati M., Akl C.F., Aleman D.M., Zandee S.E., Prat A., Douek D.C., Boritz E.A., Quintana F.J, & Abate A.R. (2023). Identification of astrocyte regulators by nucleic acid cytometry. Nature, 614(7947), 326-333.
+ Open protocol
+ Expand
4

Optimized Single-Cell RNA-seq Library Preparation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Before amplifying sorted samples, the correct number was determined to ensure that drops were not over- or under-cycled during WTA. We sorted 100 genomes based on the percent of agarose hydrogels that contained cells, determined using fluorescence microscopy as described above. A 50 μl aqueous overlay of distilled nuclease-free water was added before spinning the tubes at 20,000g for 5 min. Tubes were then frozen at −80 °C for at least 2 h and 100 μl PCR reactions were set up with a final concentration of 1× KAPA HiFi master mix (Roche, KK2601) and 0.4 μM Smart-seq2 primer (AAGCAGTGGTATCAACGCAGAGT). For 100-aliquot sorts, we amplified triplicate aliquots of 100-cell sorts using the following PCR conditions: 95 °C for 3 min, N cycles of (98 °C for 15 s, 67 °C for 20 s, and 68 °C for 4 min), followed by 72 °C for 5-minutes, then held at 4 °C, where N varied as 18, 20, or 22 for primary mouse CNS cells to identify the optimal cycle number. Libraries were purified using AMPure XP magnetic beads (Beckman Coulter, A63881) at 1.2× ratio according to the manufacturer’s protocol, then eluted in 20 μl nuclease-free water, and run on a Bioanalyzer 2100 high sensitivity DNA chip (Agilent Technologies, 5067-4626) to assess size and yield. The minimum cycle number that resulted in a concentration of greater than 2 ng μl−1 cDNA was then performed on the sorted samples.
Clark I.C., Wheeler M.A., Lee H.G., Li Z., Sanmarco L.M., Thaploo S., Polonio C.M., Shin S.W., Scalisi G., Henry A.R., Rone J.M., Giovannoni F., Charabati M., Akl C.F., Aleman D.M., Zandee S.E., Prat A., Douek D.C., Boritz E.A., Quintana F.J, & Abate A.R. (2023). Identification of astrocyte regulators by nucleic acid cytometry. Nature, 614(7947), 326-333.
+ Open protocol
+ Expand
5

Genome-wide CRISPR Screening Library Preparation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Sorted cells were lysed in 40 μl of 0.2% SDS and 2 μl of proteinase K (New England Biolabs) at 42 °C for 30 min. Then, genomic DNA (gDNA) was isolated with a 2× solid-phase reversible immobilization (SPRI) cleanup and NGS libraries were prepared from purified gDNA with a two-step PCR protocol using 2× KAPA HiFi Master Mix (Roche): first PCR: 10 μM Read1-U6 and Read2 scaffold primer mix (Supplementary Table 2); 3 min at 98 °C; 20× (10 s at 98 °C, 10 s at 62 °C, 25 s at 72 °C); 2 min at 72 °C. Second PCR: 10 μM P5 and P7 index mix: 3 min at 98 °C; 10× (10 s at 98 °C, 10 s at 62 °C, 25 s at 72 °C); 2 min at 72 °C.
Libraries were purified with 1× SPRI cleanup and sequenced at 10 M reads per sample (paired-end 50 bp in a NextSeq 1000 system). Raw data were processed with bcl2fastq (v.2.20) into FASTQ files and then processed using a custom script (see 00_NR_CRISPR_extract.pi in the analysis code)60 to isolate the 20-mer protospacers; then, they were mapped using Bowtie2 (v.2.3.4.2) using an index file containing the sgRNA sequences (Supplementary Table 2). Raw counts can be found in Supplementary Data 2.
Lara-Astiaso D., Goñi-Salaverri A., Mendieta-Esteban J., Narayan N., Del Valle C., Gross T., Giotopoulos G., Beinortas T., Navarro-Alonso M., Aguado-Alvaro L.P., Zazpe J., Marchese F., Torrea N., Calvo I.A., Lopez C.K., Alignani D., Lopez A., Saez B., Taylor-King J.P., Prosper F., Fortelny N, & Huntly B.J. (2023). In vivo screening characterizes chromatin factor functions during normal and malignant hematopoiesis. Nature Genetics, 55(9), 1542-1554.
+ Open protocol
+ Expand
6

Multiplexed CRISPR Plasmid Construction

Check if the same lab product or an alternative is used in the 5 most similar protocols
Pairs of ssDNA oligonucleotides ≤200 nt long that encode the necessary genetic parts (promoter, sgRNA, terminator) were ordered from Integrated DNA Technologies (IDT). These oligos are annealed by PCR using KAPA HiFi MasterMix (KAPA Biosystems, #07958935001) and the resulting dsDNA modules were then assembled in a one-pot Golden Gate assembly reaction using type II enzymes BsaI (New England Biolabs, #R0535S) or BsmbI (New England Biolabs, #R0580S) to generate plasmids with different numbers of sgRNAs. After transformation, these plasmids were re-purified and digested with restriction enzyme BsphI (New England Biolabs, #R0517S) to make sure they have the expected sizes and thus rule out the possibility of unwanted homologous recombination during construction and transformation (Supplementary Figure S8).
Zhang S, & Voigt C.A. (2018). Engineered dCas9 with reduced toxicity in bacteria: implications for genetic circuit design. Nucleic Acids Research, 46(20), 11115-11125.
+ Open protocol
+ Expand
7

Targeted Deep Sequencing of DNMs

Check if the same lab product or an alternative is used in the 5 most similar protocols
For candidate DNMs of interest, primers were designed to amplify 150-250 bp products centered around the site of interest. Default primer3 design settings were used with the following adjustments: GC clamp = 1, human mispriming library used. Site-specific primers were tailed with Illumina adapter sequences. PCR products were generated with JumpStart AccuTaq LA DNA polymerase (Sigma Aldrich), using 40 ng genomic DNA as template. Amplicons were tagged with Illumina PCR primers along with unique barcodes enabling multiplexing of 96 samples. Barcodes were incorporated using Kapa HiFi mastermix (Kapa Biosystems). Samples were pooled and sequenced down one lane of the Illumina MiSeq, using 250 bp paired end reads. An in-house analysis pipeline extracted the read count per site and classified inheritance status per variant using a maximum likelihood approach (see Supplementary Note).
Prevalence and architecture of de novo mutations in developmental disorders. (2017). Nature, 542(7642), 433-438.
+ Open protocol
+ Expand
8

Preparing CITE-seq Libraries for Multimodal Analysis

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
CITE-seq libraries were prepared as previously described7 (link),10 (link) following 10x Genomics 3’ v3 protocol according to manufacturer’s instructions for cDNA amplification using 0.2 μM of ADT additive primer (5’CCTTGGCACCCGAGAATTCC). The supernatant from the 0.6x SPRI cleanup was saved and purified with two rounds of 2x SPRI, and final product was used as a template to produce ADT libraries. Antibody tag libraries were generated by PCR using Kapa Hifi Master Mix (Kapa Biosciences KK2601), 10 mM 10x Genomics SI-PCR primer (5’AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC), and Small RNA RPIx primer (5’CAAGCAGAAGACGGCATACGAGATxxxxxxGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA with xxxxxx denoting one of the four following sequences: CGTGAT, ACATCG, GCCTAA, TGGTCA). Following amplification, Antibody tag libraries were cleaned up with 1.6x SPRI. Subsequently, ADT quality was verified using a DNA high sensitivity assay on an Agilent 2100 bioanalyzer.
Bashore A.C., Yan H., Xue C., Zhu L.Y., Kim E., Mawson T., Coronel J., Chung A., Ho S., Ross L.S., Kissner M., Passegué E., Bauer R.C., Maegdefessel L., Li M, & Reilly M.P. (2023). High-Dimensional Single-Cell Multimodal Landscape of Human Carotid Atherosclerosis. medRxiv.
+ Open protocol
+ Expand
9

Direct Sequencing of Proliferating T Cell CDR3s

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
To directly sequence the CDR3s from proliferating T cells assayed by Seq-Well, we applied a recently published TCR pulldown method56 (link) to WTA products from the 2-week, 3-week and 4-week timepoint samples from all four participants. Briefly, biotinylated capture probes from the TRBC region were annealed to melted WTA cDNA. Magnetic streptavidin beads were then used to pull down cDNA enriched for TRBC; this cDNA was subsequently amplified using KAPA HiFi Mastermix (Kapa Biosystems) and purified using 0.75× SeraPure beads to select for 0.8–1-kb sized DNA fragments. To select for sequences with full CDR3 regions, a pool of V-region primers was used to further amplify sequences of interest. Step-out PCR was used to add sequencing handles and the resulting libraries were sequenced on a NextSeq 550 using a 150-cycle NextSeq kit with 148 cycles for Read 1 (CDR3) and 20 cycles for Index 1 (BC + UMI). Sequences of the primers used are available in Tu et al.56 (link). CDR3 consensus sequences were aligned and determined as outlined previously. Across the entire dataset, we detected ~50% of TCR-β chain CDR3s.
Kazer S.W., Aicher T.P., Muema D.M., Carroll S.L., Ordovas-Montanes J., Miao V.N., Tu A.A., Ziegler C.G., Nyquist S.K., Wong E.B., Ismail N., Dong M., Moodley A., Berger B., Love J.C., Dong K.L., Leslie A., Ndhlovu Z.M., Ndung’u T., Walker B.D, & Shalek A.K. (2020). Integrated single-cell analysis of multicellular immune dynamics during hyperacute HIV-1 infection. Nature Medicine, 26(4), 511-518.
+ Open protocol
+ Expand
10

Amplicon bisulfite sequencing for epigenomic analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
To obtain increased sequencing depth, amplicon bisulphite sequencing (AmpBS-seq) libraries were prepared from the second 2i release experiment. Regions of interest where chosen from exemplary enhancers showing oscillatory dynamics correlated to the global H3K4me1 trends in the BS-seq data from the first 2i release experiment. Total nucleic acid isolated from the 2i release experiment underwent bisulfite conversion using Zymo reagents as described above. KAPA HiFi Uracil+ Master Mix (Kapa Biosystems) was used to amplify regions of interest using 30nM primers (Table S3), with the reverse primer including an 8N unique molecular identifier (UMI). The PCR program was: 95C 5min; 35 repeats of 98C 20s, 60C 15s, 72C 60s; 72C 10min. Amplicons were pooled for each sample and purified using Ampure XP beads (Agencourt), before a second round of PCR was used to incorporate Illumina Adaptor sequences and index samples. The PCR reaction included 11ul pooled amplicons, 200nM indexed PE1.0 (Table S5) and iPCRTag primers (Quail et al., 2011 (link)), and KAPA HiFi Master Mix (Kapa Biosystems). The PCR program was: 98C 45s; 5 repeats of 98C 15s, 65C 30s, 72C 30s; 72C 5min. Samples were then pooled and purified before library QC and sequencing was performed with up to 144 samples included on a 150bp paired-end MiSeq run.
Rulands S., Lee H.J., Clark S.J., Angermueller C., Smallwood S.A., Krueger F., Mohammed H., Dean W., Nichols J., Rugg-Gunn P., Kelsey G., Stegle O., Simons B.D, & Reik W. (2018). Genome-Scale Oscillations in DNA Methylation during Exit from Pluripotency. Cell Systems, 7(1), 63-76.e12.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!