Taqman advanced microrna cdna synthesis kit

Manufactured by Thermo Fisher Scientific

Sourced in United States

The TaqMan™ Advanced microRNA cDNA Synthesis Kit is a laboratory equipment product designed for the reverse transcription of microRNA (miRNA) into complementary DNA (cDNA) for downstream quantitative PCR (qPCR) analysis. The kit provides a streamlined workflow for the synthesis of cDNA from miRNA samples.

Automatically generated - may contain errors

Lab products found in correlation

16 protocols using taqman advanced microrna cdna synthesis kit

Extracellular Vesicle miRNA Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Encapsulated miRNAs were extracted from circulating EVs using miRNase (Qiagen, Germantown, MD, USA), according to the manufacturer’s instructions. Briefly, templates were made from 10 ng of total RNA using an TaqMan advanced microRNA cDNA synthesis kit (Life Technologies). Real-time PCR quantification for miRNA expression was performed using a TaqMan miRNA expression assay from Life Technologies. Cycle quantification (Cq) value was converted to relative number using power formulation.

Povero D., Tameda M., Eguchi A., Ren W., Kim J., Myers R., Goodman Z.D., Harrison S.A., Sanyal A.J., Bosch J., Ohno-Machado L, & Feldstein A.E. (2022). Protein and miRNA profile of circulating extracellular vesicles in patients with primary sclerosing cholangitis. Scientific Reports, 12, 3027.

+ Open protocol

+ Expand

Quantitative Analysis of Plasma miRNA Levels

Check if the same lab product or an alternative is used in the 5 most similar protocols

The quantitative polymerase chain reaction procedure used to measure microRNA levels and was performed as described previously [13] (link). RNA was extracted from 100 µL of plasma using a Mir-Vana kit (Life Technologies) following the manufacturer's protocol. 2 µL of extracted RNA was used to perform reverse transcription with a TaqMan Advanced MicroRNA cDNA Synthesis Kit (Life Technologies). cDNA samples were diluted 10× before the qPCR reaction. qPCR was conducted on 384-well plates with TaqMan Advanced Mas-terMix and TaqMan Advanced Assays targeting: hsa-miR-21-5p, hsa-mir-26a-5p, hsa-miR-29b-3p, hsa-miR-30c-5p, and hsa-miR-133a-3p. 15 mL reactions were prepared with pipetting station Bravo (Agilent Technologies) and a real-time reaction was run and read on a CFX384 Real Time PCR Detection System (Bio-Rad). Mean Cq values were normalized to the geometric mean of hsa-miR--15b-5p and hsa-miR-16-5p, which were selected as relatively stable controls in pilot experiments. Normalized data was expressed for each sample as [2 -DCq ] where DCq is the difference between the Cq value between the microRNA of interest and the geometric mean of miR-15b and miR-16 for a particular sample.

Rubiś P., Totoń-Żurańska J., Wiśniowska-Śmiałek S., Kołton-Wróż M., Wołkow P., Wypasek E., Rudnicka-Sosin L., Pawlak A., Kozanecki K., Tomkiewicz-Pająk L, & Podolec P. (2018). Right ventricular morphology and function is not related with microRNAs and fibrosis markers in dilated cardiomyopathy. Cardiology journal, 25(6).

+ Open protocol

+ Expand

Quantification of Urinary and Serum miRNAs

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

The protocol was also described previously [27 (link)]. Briefly, complementary DNA (cDNA) was prepared from miRNA samples using TaqMan Advanced MicroRNA cDNA Synthesis Kit (Applied Biosystems, Foster, CA, USA), according to the manufacturer’s instructions. Quantitative PCRs were conducted in duplicate using the TaqMan Advanced MicroRNA Assay (Applied Biosystems) and TaqMan Fast Advanced Master Mix (Applied Biosystems) by 7500 Fast Real-Time PCR system (Applied Biosystems). We calculated cycle threshold (Ct) values to quantify miRNA expression using the 2^−∆Ct method. Internal controls for normalization in qPCR of urinary miRNA were determined using a global mean normalization method with the microarray results [32 (link)]. Therefore, miR-4669 and miR-6756-5p were determined to be the internal normalization controls for qPCR of urinary and serum miRNAs, as shown in the previous study [28 (link)]. As the internal normalizer for the qPCR of miRNA in FFPE tissues, we used RNU6B. The reagents used in qRT-PCR were listed in Table S1.

Iwasaki H., Shimura T., Kitagawa M., Yamada T., Nishigaki R., Fukusada S., Okuda Y., Katano T., Horike S.I, & Kataoka H. (2022). A Novel Urinary miRNA Biomarker for Early Detection of Colorectal Cancer. Cancers, 14(2), 461.

+ Open protocol

+ Expand

Validation of miRNA Expression by RT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Technical validation using quantitative real-time PCR (RT-PCR) was done in the same cohort of samples used for sequencing. A couple of miRNAs were selected based on published literature, novelty and availability of TaqMan primers. First, 5 ng of RNA was reverse transcribed to cDNA using the TaqMan Advanced microRNA cDNA synthesis Kit (Applied Biosystems, USA), and this was followed by RT-PCR using TaqMan advanced microRNA assays (Applied Biosystems, USA) on a One Step Plus Real-time PCR system (Applied Biosystems, Singapore) according to the manufactures protocol. Each sample was run in triplicates to allow for assessment of technical variability. Fold change (FC) was calculated using the comparative Ct-method. An endogenous control miRNA was selected by performing RT-PCR for 30 commonly expressed miRNAs using TaqMan™ Advanced miRNA Human Endogenous Controls 96-well Plate (Thermo Fischer, Catalogue No: A34643). Based on a high and stable abundance in UF, hsa-miR-423-5p was chosen as endogenous control. The abundancy pattern of the reference miRNA in the sequencing data is shown in Supplementary Fig. S1A. One sample in the healthy group was excluded since it was considered as an extreme outlier with CT values >39 for the housekeeping gene in all PCR runs. RT-PCR primer assay IDs are available in Supplementary Table SI.

von Grothusen C., Frisendahl C., Modhukur V., Lalitkumar P.G., Peters M., Faridani O.R., Salumets A., Boggavarapu N.R, & Gemzell-Danielsson K. (2022). Uterine fluid microRNAs are dysregulated in women with recurrent implantation failure. Human Reproduction (Oxford, England), 37(4), 734-746.

+ Open protocol

+ Expand

Gene and miRNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

For gene expression analysis, the total RNA was extracted from cells using Trizol reagent (Ambion, Waltham, MA, USA) and reverse transcription (RT) was carried out using SuperScript VILO Master Mix (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol. Quantitative polymerase chain reaction (qPCR) was performed using TaqMan Probe system (Roche Diagnostics) on the Applied Biosystems 7500 (Applied Biosystems/ThermoFisher Scientific, Foster City, CA, USA) with GAPDH as the internal control. Relative expression to normalizer sample was calculated using the ΔΔCT method.
To measure miRNA expression, total RNA was extracted using mirVana miRNA Isolation Kit (Ambion) and reverse‐transcribed to cDNA using TaqMan Advanced MicroRNA cDNA Synthesis Kit (Applied Biosystems/ThermoFisher Scientific, Foster City, CA, USA). qPCR was performed using TaqMan Advanced MicroRNA Assay kit (ThermoFisher Scientific, Waltham, MA, USA) following the manufacturer's instructions. The relative expression of hsa‐let‐7i‐5p was normalized to that of hsa‐miR‐191‐5p.

Elkhadragy L., Chen M., Miller K., Yang M, & Long W. (2017). A regulatory BMI1/let‐7i/ERK3 pathway controls the motility of head and neck cancer cells. Molecular Oncology, 11(2), 194-207.

+ Open protocol

+ Expand

Validating miRNA Expression via qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Leftover RNA from the same samples used for the Nanostring analyses was used to validate select miRNAs. For each sample, approximately 45 ng of purified RNA were used to prepare cDNA using the Taqman® Advanced MicroRNA cDNA synthesis kit (Applied Biosystems, Foster City, CA, USA, # A28007), Taqman® Advanced MicroRNA Assay primers (Life Technologies, Grand Island, NY, USA) for miR-376c-3p, miR-107-3p, and miR-212-3p, and Taqman® MicroRNA Assay primer for the control transcript U6. cDNA for each sample was diluted 1:100 with nuclease-free water, then run in triplicate for each miRNA and U6. Relative expression was determined using the comparative 2^−ΔCt method (Livak and Schmittgen, 2001 (link)).

Vannan A., Powell G.L., Dell’Orco M., Wilson M.A., Perrone-Bizzozero N.I, & Neisewander J.L. (2021). microRNA regulation related to the protective effects of environmental enrichment against cocaine-seeking behavior. Drug and alcohol dependence, 221, 108585.

+ Open protocol

+ Expand

Quantitative Analysis of Gene and miRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Transfected cells were harvested after 24 and 48 h post-transfection. Total RNA was isolated using the RNeasy Plus Mini kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. RNA content was measured using a NanoDrop spectrophotometer ND-1000 with subsequent cDNA synthesis using the Ominscript RT kit (Qiagen, Hilden, Germany) according to the provided protocol. RT-PCR was performed using the iQ SYBR green supermix (Bio RAD, Portland, ME). Expression analysis was executed in triplicates and the expression of HPRT was used as a reference gene. PCR primers (Gene accession number: NM_004059, NM_000194) are as follows:
KYAT1 F: CACGCTGTCAGTGGAGACTT, R: TATCTCCTGACCCAGCAGCT.
HPRT1 F: GCAGACTTTGCTTTCCTTGG, R: TATCCAACACTTCGTGGGGT.
For microRNA expression analysis, 10 ng of RNA was used for synthesizing cDNA using a Taqman advanced microRNA cDNA synthesis kit (Applied Biosystems Inc., Foster City, CA, USA) followed by Taqman advanced microRNA assay (Applied Biosystems Inc., Foster City, CA, USA) and qRT-PCR was performed by TaqMan fast advanced master mix (Applied Biosystems Inc., Foster City, CA, USA). miR122-5p (#477855-mir) expression analysis was executed in triplicate and the expression of miR192-5p (#478262-mir) and miR16-5p (#477860-mir) was used as reference genes. All miRNAs probes were bought from Applied Biosystems Inc., Foster City, CA, USA.

Selvam A.K., Jawad R., Gramignoli R., Achour A., Salter H, & Björnstedt M. (2021). A Novel mRNA-Mediated and MicroRNA-Guided Approach to Specifically Eradicate Drug-Resistant Hepatocellular Carcinoma Cell Lines by Se-Methylselenocysteine. Antioxidants, 10(7), 1094.

+ Open protocol

+ Expand

Extracellular Vesicle RNA Isolation Protocol

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

pEVs were processed for RNA isolation using the “Maxwell RSC miRNA plasma and serum kit” (Cat# AS1680; Promega). Three synthetic spike-ins (Ath-miR-159a, Cel-miR-254, osa-miR-414) were added to samples after lysis to assess RNA isolation efficiency. Isolated RNA was subjected to quality control for hemolysis detection using the ratio of miR-23a to miR-451 [26 (link)–28 (link)]. Two microliters of RNA were reverse transcribed to complementary DNA (cDNA) using the TaqMan Advanced MicroRNA cDNA synthesis Kit (Cat# A28007; ThermoFisher Scientific, Rockford, USA) according to the manufacturer's protocol.

Sabato C., Noviello T.M., Covre A., Coral S., Caruso F.P., Besharat Z.M., Splendiani E., Masuelli L., Battistelli C., Vacca A., Catanzaro G., Po A., Anichini A., Maio M., Ceccarelli M., Di Giacomo A.M, & Ferretti E. (2022). A novel microRNA signature for the detection of melanoma by liquid biopsy. Journal of Translational Medicine, 20, 469.

+ Open protocol

+ Expand

Profiling microRNA Expression by qRT-PCR

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

TaqMan™ Advanced microRNA cDNA Synthesis Kit and TaqMan™ Advanced microRNA assays were used under the default settings on QuantStudio™ 3 from ThermoFisher Scientific, Waltham, MA, USA. The cDNA samples were stored at − 20 °C. Based on literature research [7 (link), 18 (link)–20 (link)], the following 13 miRNAs were analyzed: miR-10a-5p, miR-15a-5p, miR-16-5p, miR-19b-3p, miR-26b-5p, miR-29c-3p, miR-106b-5p, miR-126-3p, miR-142-3p, let-7a-5p, let-7g-5p, miR-21-5p, and miR-877-5p, as well as two endogenous controls (miR-24-3p and miR-93-5p). ∆Ct was used to evaluate the expression pattern and calculated as follows:

Δ C t = C t^{target} - C t^{e n d o g e n o u s c o n t r o l}

[21 (link)].

Krammer U.D., Lerch M.L., Haslberger A.G, & Hippe B. (2023). MiR-10a, miR-15a, let-7a, and let-7g expression as stress-relevant biomarkers to assess acute or chronic psychological stress and mental health in human capillary blood. Molecular Biology Reports, 50(7), 5647-5654.

+ Open protocol

+ Expand

Quantifying mtDNA and miRNA Levels

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The mtDNA content was measured in the gDNA samples. For the qPCR, a StepOne Plus real-time PCR Detection System (Applied Biosystems, Waltham, MA, USA), a single-copy gene primer (fw: GCT TCT GAC ACA ACT GTG TTC ACT AGC, rev: CAC CAA CTT CAT CCA CGT), mtDNA primer (fw: CAT CTG GTT CCT ACT TCA GGG, rev: TGA GTG GTT AAT AGG GTG ATA GA; Biomers, Ulm, Germany) [29 (link)] and a LightCycler^® 480 Sybr^® Green I Master Mix (Roche, Munich, Germany) were used. For the miRNA analyses, we used the TaqMan™ Advanced microRNA cDNA Synthesis Kit and TaqMan™ Advanced microRNA assays (miR-23a-3p, -30e-3p, and endogenous controls miR-24-3p and -93-5p) under the default settings on QuantStudio™ 3 from ThermoFisher Scientific, Waltham, MA, USA. Fold changes were calculated with the formula 2^−∆∆Ct [30 (link)].

Δ C t = C t^{t a r g e t} - C t^{e n d o g e n o u s c o n t r o l} Δ Δ C t = Δ C t^{T 1} - Δ C t^{T 0}

Krammer U.D., Sommer A., Tschida S., Mayer A., Lilja S.V., Switzeny O.J., Hippe B., Rust P, & Haslberger A.G. (2022). PGC-1α Methylation, miR-23a, and miR-30e Expression as Biomarkers for Exercise- and Diet-Induced Mitochondrial Biogenesis in Capillary Blood from Healthy Individuals: A Single-Arm Intervention. Sports, 10(5), 73.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!