Log In Sign up
The largest database of trusted experimental protocols

Faststart universal sybr green master mix rox

Manufactured by Thermo Fisher Scientific
Visit Supplier
Sourced in China

FastStart Universal SYBR Green Master Mix (Rox) is a ready-to-use real-time PCR reagent that contains SYBR Green I dye and passive reference dye Rox. It is designed for the quantification of DNA targets.

Automatically generated - may contain errors

Lab products found in correlation

Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions) Reverse transcription kit, by Takara Bio (1 mentions) Quantstudio design analysis desktop software, by Thermo Fisher Scientific (1 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions) Nanodrop 8000, by Thermo Fisher Scientific (1 mentions) Hypure molecular biology grade water, by Thermo Fisher Scientific (1 mentions) Biorad dc protein assay reagent package, by Bio-Rad (1 mentions) Olive oil, by Merck Group (1 mentions) Glutathione peroxidase gsh px kit, by Nanjing Jiancheng (1 mentions)

2 protocols using faststart universal sybr green master mix rox

1

Gene Expression Analysis by qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted using TRIzol Reagent (15596026, Invitrogen, USA) according to the manufacturer’s instructions. The quality and quantity of the RNA samples obtained were subjected to spectrophotometric analysis using a bio-photometer (Thermo Scientific™ NanoDrop8000). The RNA was then reverse transcribed into complementary DNA (cDNA) using a Reverse Transcription kit (RR037A, Takara Bio Inc., Japan). Quantitative real-time polymerase chain reaction (qPCR) was performed using a FastStart Universal SYBR Green Master Mix (Rox) system with QuantStudio Design & Analysis Desktop Software (Thermo Fisher Scientific). The primer sequences are shown in Table 3. Glyceraldehyde-3-phosphate dehydrogenase (Gapdh) was utilized as the internal control.

Primer sequences used for quantitative real-time PCR analysis

Target geneForward sequence (5′−3′)Reward sequence (5′−3′)
Runx2CAGTATGAGAGTAGGTGTCCCGCAAGAGGGGTAAGACTGGTCATAGG
Smad1CCCCAACAGCAGCTACCCCAACTCTGGGCCATGGGGTCTTCAGGAG
Sp7CTGGGAAAAGGAGGCACAAAGAGGGGAAAGGGTGGGTAGTCATT
Cola1AGAGGCATAAAGGGTCATCGTGAGACCGTTGAGTCCATCTTTGC
GapdhCTGGAGAAACCTGCCAAGTATGGGTGGAAGAATGGGAGTTGCT
Liu W., Zhao H., Zhang C., Xu S., Zhang F., Wei L., Zhu F., Chen Y., Chen Y., Huang Y., Xu M., He Y., Heng B.C., Zhang J., Shen Y., Zhang X., Huang H., Chen L, & Deng X. (2023). In situ activation of flexible magnetoelectric membrane enhances bone defect repair. Nature Communications, 14, 4091.
+ Open protocol
+ Expand
2

Hepatoprotective Potential of H. japonicum

Check if the same lab product or an alternative is used in the 5 most similar protocols
H. japonicum Thunb. ex Murray was purchased from Kangmei Pharmaceutical Co., Ltd. (Puning, China); α-naphthyl isothiocyanate (ANIT, 98%) was purchased from Shanghai Macklin Biochemical Co., Ltd. (Shanghai, China); quercetin (>98.0%) and ursodeoxycholic acid (UCDA, >98%) were purchased from Dalian Melone Biology Technology Co., Ltd. (Dalian, China). Olive oil was purchased from Sigma Aldrich Trading Co., Ltd. (Shanghai, China). Malondialdehyde (MDA), superoxide dismutase (SOD), direct bilirubin (DBIL), total bilirubin (TBIL), total bile acid (TBA), ALT, and AST assay kits and glutathione peroxidase (GSH-Px) kits were purchased from the Nanjing Jiancheng Bioengineering Institute (Nanjing, China). The Bio-Rad DC protein assay reagent package was purchased from Bio-Rad Laboratories (CA, USA). HyPure molecular biology grade water, FastStart Universal SYBR Green Master mix (Rox), and RevertAid First Strand cDNA synthesis kit were purchased from Thermo Fisher Scientific Co., Ltd. (Shanghai, China). The primers against PTGS2, B-cell lymphoma-2 (BCL2), cholesterol 7-alpha hydroxylase (CYP7A1), farnesoid X receptor (FXR), interleukin-1 beta (IL-1β), and tumor necrosis factor alpha (TNF-α) were purchased from Servicebio Technology Co., Ltd. (Wuhan, China). All other chemicals and reagents were of analytical grade or higher and were purchased from commercial sources.
Feng S.L., Zhang J., Jin H., Zhu W.T, & Yuan Z. (2021). A Network Pharmacology Study of the Molecular Mechanisms of Hypericum japonicum in the Treatment of Cholestatic Hepatitis with Validation in an Alpha-Naphthylisothiocyanate (ANIT) Hepatotoxicity Rat Model. Medical Science Monitor : International Medical Journal of Experimental and Clinical Research, 27, e928402-1-e928402-14.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!