Pad block it system

Manufactured by Thermo Fisher Scientific

Sourced in United States

The PAD/Block-it system is a lab equipment product offered by Thermo Fisher Scientific. It is designed to perform protein blocking and antibody incubation steps during Western blot or immunohistochemistry procedures. The system provides a controlled environment for these critical steps, helping to ensure consistent and reliable results.

Automatically generated - may contain errors

Lab products found in correlation

Adeno x rapid titer kit, by Takara Bio (6 mentions) Pd 10 column, by GE Healthcare (6 mentions) Hek293a cells, by Thermo Fisher Scientific (1 mentions) Adeno xtm rapid titer kit, by Takara Bio (1 mentions)

7 protocols using pad block it system

Adenoviral Delivery of Mouse shRNAs and Overexpression Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols

ShRNAs for lncLGR and hnRNPL were designed to act against mouse sequences (lncLGR shRNA: GCACAGCTGTATTAGAATTGT; hnRNPL shRNA: GCCTACGCG TTTAAATGTA). Hairpin template oligonucleotides were synthesized by Integrated DNA Technologies and were subsequently cloned into the adenovirus vector of the pAD/Block-it system (Invitrogen) according to the manufacturer’s protocols. Overexpression constructs of lncLGR, lncLGR Δ1-335 and mouse liver GCK were generated by PCR-amplifying from mouse liver cDNA using the primers as: lncLGR-f: TCTAAAAGCAAAGGAAGAAATGA-3, lncLGR-r: CACTGTCAAAACACTTTTAA TGA; lncLGR Δ1-335-f: ATTCCAGGTGTTGAGCTGAGAAAG, GCK-f: ATGGCTGT GGATACTACAAG, GCK-r: TCACTGGCCCAGCATGCAAC. PCR products were subsequently cloned into the pAdv5 adenovirus vector for virus packaging. Adenoviruses were amplified in HEK293A cells and purified by CsCl gradient centrifugation. Purified viruses were desalted with PD10 columns (GE Healthcare Life Sciences) and titered with Adeno-X Rapid Titer Kit (Clontech). Adenoviruses were delivered into mice intravenously at 1–2×10⁹ pfu/mouse. After seven to twelve days, animal experiments were performed, and tissue samples and plasma were harvested for further analyses.

Ruan X., Li P., Cangelosi A., Yang L, & Cao H. (2016). A Long Non-coding RNA, lncLGR, Regulates Hepatic Glucokinase Expression and Glycogen Storage during Fasting. Cell reports, 14(8), 1867-1875.

+ Open protocol

+ Expand

Adenoviral Knockdown and Rescue of lncRNAs

Check if the same lab product or an alternative is used in the 5 most similar protocols

The shRNAs for lncLSTR, FXR and apoC2 were designed to act against mouse sequences (lncLSTR shRNA1: GTTGGAAGCTCTAAATAAA, shRNA2: GACGATTGCTACATGTATA; FXR shRNA: GTGTAAATCTAAACGGCTA; apoC2 shRNA: TCCCTTCCTGCCACTACAT). The hairpin template oligonucleotides were synthesized by Integrated DNA Technologies and were subsequently cloned into the adenovirus vector of the pAD/Block-it system (Invitrogen) according to the manufacturer’s protocols. Rescue construct of lncLSTR was generated by PCR-amplifying a truncated lncLSTR that lack 299bp at 5’ end carrying the shRNA1 target sequence, and it was subsequently cloned into pAdv5 adenovirus vector for virus packaging. Adenoviruses were amplified in HEK293A cells and purified by CsCl gradient centrifugation. Purified viruses were desalted with PD10 columns (GE Healthcare Life Sciences) and titered with Adeno-X Rapid Titer Kit (Clontech). Adenoviruses were delivered into mice intravenously at 1-2×10⁹ pfu/mouse. In the case of double-knockdown experiments, two viruses of equal titer were first mixed, then each mouse received 2×10⁹ pfu total virus. After seven to twelve days, animal experiments were performed, and tissue samples and plasma were harvested for further analysis.

Li P., Ruan X., Yang L., Kiesewetter K., Zhao Y., Luo H., Chen Y., Gucek M., Zhu J, & Cao H. (2015). A liver-enriched long non-coding RNA, lncLSTR, regulates systemic lipid metabolism in mice. Cell metabolism, 21(3), 455-467.

+ Open protocol

+ Expand

Adenoviral Delivery of shRNAs and Overexpression Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols

The shRNAs for LINC01018, human HuR and mouse HuR were designed using the following sequences (LINC01018 shRNA1: CCTTAAACTTGTACCACTT; LINC01018shRNA2: GCAAGAAGACCCAGCTATT; human HuR shRNA: GGCTTTGTGACCATGACAA; mouse HuR shRNA: GGTTTGGGCGAATCATCAA). The hairpin template oligonucleotides were synthesized by Integrated DNA Technologies and were subsequently cloned into the adenovirus vector of the pAD/Block-it system (Invitrogen) according to the manufacturer’s protocols. Overexpression construct of LINC01018 was generated by PCR-amplifying the sequence of NR_024424.2 using human liver cDNA sample. The sequence was subsequently cloned into pAdv5 adenovirus vector for virus packaging. Adenoviruses were amplified in HEK293A cells (Invitrogen) and purified by CsCl gradient centrifugation. Purified viruses were desalted with PD10 columns (GE Healthcare Life Sciences) and titered with Adeno-X Rapid Titer Kit (Clontech). Adenoviruses were delivered into mice intravenously at 5 × 10⁸ pfu/mouse for overexpression, 1–2 × 10⁹ pfu/mouse for knocking down experiments. In the case of double-knockdown experiments, two viruses of equal titer were first mixed, then each mouse received 2 × 10⁹ pfu total virus. After seven days, tissue samples were harvested for further analysis.

Ruan X., Li P., Chen Y., Shi Y., Pirooznia M., Seifuddin F., Suemizu H., Ohnishi Y., Yoneda N., Nishiwaki M., Shepherdson J., Suresh A., Singh K., Ma Y., Jiang C.F, & Cao H. (2020). In vivo functional analysis of non-conserved human lncRNAs associated with cardiometabolic traits. Nature Communications, 11, 45.

+ Open protocol

+ Expand

Adenovirus Production and shRNA Design

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The adenovirus was produced using pAD/Block-it system (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocols and were purified byCsCl gradient centrifugation. The purified adenovirus was desalted with PD10 columns (GE Healthcare Life Sciences, Marlborough, MA, USA) and titered with Adeno-X Rapid Titer Kit (Clontech, Mountain View, CA, USA) which was previously described [12 (link)]. The shRNAs were designed using the following sequences: human HuR shRNA: GGCTTTGTGAC CATGACAA; mouse HuR shRNA: GGTTTGGGCGAATCATCAA).

Jiang C., Li P., Ruan X., Ma Y., Kawai K., Suemizu H, & Cao H. (2020). Comparative Transcriptomics Analyses in Livers of Mice, Humans, and Humanized Mice Define Human-Specific Gene Networks. Cells, 9(12), 2566.

+ Open protocol

+ Expand

Adenovirus Vector Generation and Titration

Check if the same lab product or an alternative is used in the 5 most similar protocols

Ad-shRaptor and control Ad-shGFP vectors were generated using the pAdBLOCK-iT system (Invitrogen, USA). Adenoviruses were amplified in HEK293A cells and purified by CsCl gradient centrifugation. The adenoviruses were titered using an Adeno-XTM Rapid Titer kit (Takara Bio, China) according to the manufacturer’s manual.

Xu L., Zhang X., Xin Y., Ma J., Yang C., Zhang X., Hou G., Dong X.C., Sun Z., Xiong X, & Cao X. (2021). Depdc5 deficiency exacerbates alcohol-induced hepatic steatosis via suppression of PPARα pathway. Cell Death & Disease, 12(7), 710.

+ Open protocol

+ Expand

Overexpression and Knockdown of Txnip and Chop Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

For overexpression, the coding sequence (CDS) of Txnip or Chop was obtained by PCR from mouse liver cDNA and subcloned into adenoviral vector pAd/CMV/V5-DEST (Cat.V49320, Invitrogen, USA) according to the manufacturer's protocols. For knockdown, the hairpin template oligonucleotides were synthesized by Integrated DNA Technologies and were subsequently cloned into the adenovirus vector of the pAD/Block-it system (Invitrogen) according to the manufacturer's protocols. The shRNA oligonucleotides are listed in Supplementary Table S3. Adenoviruses were produced and amplified in HEK293A cells. Adenoviruses were purified by CsCl density-gradient ultracentrifugation and desalted using PD10 columns (GE Healthcare Life Sciences). Titration was applied using Adeno-X Rapid Titer Kit (Clontech, USA). Adenoviral transduction of target cells with a level of 50 multiplicity of infection (MOI) was performed to test the expression of target genes.

Guo Q., Xin M., Lu Q., Feng D., Yang V., Peng L.F., Whelan K.A., Hu W., Wu S., Yang X., Wang H., Rothberg B.S., Gamero A.M., Gerhard G.S., Gao B, & Yang L. (2023). A novel NEDD4L-TXNIP-CHOP axis in the pathogenesis of nonalcoholic steatohepatitis. Theranostics, 13(7), 2210-2225.

+ Open protocol

+ Expand

Adenoviral Delivery of shRNA and Overexpression Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols

The shRNAs for hLMR1 and mouse Ptbp1 were designed using the following sequences (hLMR1 shRNA: CCTTCACAGCTCTGCCTAA; mouse Ptbp1 shRNA: GCACCGTCCTGAAGATCAT).
The hairpin template oligonucleotides were synthesized by Integrated DNA Technologies and were subsequently cloned into the adenovirus vector of the pAD/Block-it system (Invitrogen) according to the manufacturer's protocols. Overexpression construct of hLMR1 was generated by PCR-amplifying the sequence of ENST00000476385.1 using human liver cDNA sample. The sequence was subsequently cloned into pAdv5 adenovirus vector for virus packaging.
Adenoviruses were amplified in HEK293A cells and purified by CsCl gradient centrifugation.
Purified viruses were desalted with PD10 columns (GE Healthcare Life Sciences) and titered with Adeno-X Rapid Titer Kit (Clontech). Adenoviruses were delivered into mice intravenously at 5 × 10 8 pfu/mouse for overexpression experiments, 1 × 10 9 pfu/mouse for knockdown experiments.
After seven days, tissue samples were harvested for further analysis.

Ruan X., Li P., Ma Y., Jiang C., Chen Y., Shi Y., Gupta N., Seifuddin F., Pirooznia M., Suemizu H., Ohnishi Y., Yoneda N., Nishiwaki M., & Cao H. (2020). Multilevel integrative transcriptome analyses in humans and humanized mice define in vivo human lncRNA metabolic regulators.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!