In fusion hd ecodry cloning plus kit

The I942E-EGFR pcDNA3 plasmid and IIIV/KKRE-EGFR plasmid were gifts from Prof. J. Kuriyan (University of California Berkley). The wtEGFR pCDNA3 plasmid used as a control in the western blot experiments was a gift from Prof. Y. Yarden (Weizmann Institute of Science). The L834R-EGFR pCDNA3 and T766M-EGFR pCDNA3 plasmids were produced through site-directed mutagenesis using the primers described in Supplementary Table 5. Reactions were performed using a site-directed mutagenesis kit from Stratagene following the manufacturer’s instructions. EGFR IIIV/KKRE was amplified by PCR using primers containing infusion tags (described in Supplementary Table 5) for the insertion of the PCR product into the pOPINE vector^{80 (link)} cut with NcoI and PmeI (gift from Prof Ray Owens, University of Oxford). The In-Fusion® HD EcoDry™ Cloning Plus kit (Takara) was used according to the manufacturer’s instructions. The final product was confirmed by complete sequencing. Transfections were performed in solution at the same time as seeding, using Viafect (Promega) as a carrier for the I942E-EGFR, L834R-EGFR, T766M-EGFR and wtEGFR plasmids. GeneJuice (Merck Millipore) was used as a carrier for IIIV/KKRE-EGFR. In all cases expression was allowed to proceed for 48 h prior to further experimental manipulations.

In-fusion cloning was performed using the In-Fusion HD EcoDry Cloning Plus kit (Takara), and standard cut-and-paste cloning using T7 DNA ligase (New England Biolabs). NES_Rev: LPPLERLTL. NES_PKI: LALKLAGLDI. See Supplementary file 2c for more details.

The generation of the poFV-GFP plasmid has been described previously [33 ]. To generate poFV-TK we linearized the poFV-GFP backbone with BspEI and SacII restriction enzymes (the GFP cDNA was cut out), added a T2A sequence to the TK in a PCR reaction (using the following primers: Forward attacccgcggGAAGGACGGGGGAGCCTCCTGACATGTGGCGACGTGGAGGAGAATCCCGGACCCATGGCTTCGTACCCCTGCCA; Reverse: gccgcgaccggtTCAGTTAGCCTCCCCCATCT) and ligated with the linearized backbone upon PCR product digestion with BspEI and SacII restriction enzymes. iCasp9 cDNA was cloned into the poFV backbone by adding a T2A sequence as well as overhangs homologous to both ends of the linearized poFV-GFP plasmid in a PCR reaction (primers used for iCasp9: forward TTATAGAAATTACCCGCGGGAAGGACGGGGGAGCCTCCTGACATGTGGCGACGTGGAGGAGAATCCCGGACCCATGCTCGAGGGAGTGCAGGT, reverse: CTCTCTGAGGTCCGGATTAGTCGAGTGCGTAGTCTGG) and inserting it into the linearized poFV backbone using In-Fusion HD EcoDry Cloning Plus kit (Takara). The constructs were then sequenced to confirm the presence and correctness of the transgenes.