Plenti cmv v5 luciferase

Lenti-X 293T cells were purchased from Clontech. Lenti-X 293T and AML cell lines (HL60, OCIAML3, THP-1, MOLM13, MV411) were maintained in RPMI media supplemented with 10% cosmic serum (GE Healthcare) and 100U/ml Penicillin with 100μg/ml Streptomycin (GE Healthcare). MV411-luciferase cells were generated by stably transfecting MV411 cells using the plasmid pLenti-CMV V5-luciferase (Addgene). Patient samples were obtained from Hematopoietic biorepository and cellular therapy core at Case Western Reserve University. All work on human patient samples were approved by Institutional Review Board at University Hospitals Cleveland Medical Center. All patient samples were derived from bone marrow, had >60% leukemic blasts, and underwent ficoll purification to isolate mononuclear cells prior to testing. Primary leukemic cells were cultured in IMDM media (GE Healthcare) with 20% serum supplemented with 20ng/ml Granulocyte Stem cell factor (Gold Biotechnology). Transient transfections were performed using Turbofect (ThemoFisher Scientific) following manufacturer’s protocols. Stable transfections were obtained by using shRNA constructs - Control shRNA (SHC002) and TXNRD1 shRNA (TRCN0000046533 (#1) and TRCN0000046535 (#2)) from Sigma as well as the CRISPR construct pLV[CRISPR]-hCas9:T2A:Puro-U6>hTXNRD with the following guide sequence TATGTCGCTTTGGAGTGCGC from VectorBuilder.