Total RNA was isolated with the RNeasy kit (Qiagen) according to the manufacturer's protocol. Total RNA (500 ng) was reverse transcribed into cDNA. Quantitative polymerase chain reaction was carried out on an ABI 7500 fast real‐time polymerase chain reaction system (Applied Biosystems, Foster City, CA). Fold changes in gene expression were acquired by using the delta method and normalization to 18 S rRNA. The primers used in this process were 5′‐CAATCCCATGGCGTATAAAAGCATC‐3′ (RELMα forward), 5′‐TCATTCTTAGGACAGTTGGCAGCAG‐3′ (RELMα reverse), 5′‐TGAGCAAGAGAGGCCCTATC‐3′ (GAPDH forward), and 5′‐AGGCCCCTCCTGTTATTATG‐3′ (GAPDH reverse).
Abi 7500 fast real time polymerase chain reaction system
Manufactured by Thermo Fisher Scientific
Sourced in United States
The ABI 7500 Fast Real-Time PCR System is a laboratory instrument designed for real-time polymerase chain reaction (PCR) analysis. It is capable of performing rapid thermal cycling and precise fluorescence detection to facilitate the quantification of target nucleic acid sequences.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy kit, by Qiagen (1 mentions)
Taqman advanced mirna cdna synthesis kit, by Takara Bio (1 mentions)
First strand cdna synthesis kit, by Takara Bio (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Sybr green pcr kit, by Takara Bio (1 mentions)
Taqman pre designed snp genotyping assay, by Thermo Fisher Scientific (1 mentions)
3 protocols using abi 7500 fast real time polymerase chain reaction system
1
Quantitative RT-PCR Analysis of Gene Expression
2
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from PDAC tissues or cells by use of TRIzol Reagent (Invitrogen). Afterwards, RNAs were reversely transcribed into cDNA with TaqMan™ Advanced miRNA cDNA Synthesis Kit (for mRNA and lncRNA; Waltham, MA, USA) or First Strand cDNA Synthesis Kit (for miRNA; Takara, Otsu, Japan). The RT-qPCR analysis was conducted on ABI 7500 Fast Real-Time polymerase chain reaction system (Applied Biosystems, Foster City, CA, USA) via using SYBR Green PCR Kit (Takara, Japan). The relative expression of genes was calculated with the 2−ΔΔCt method. All data were normalized to the expression of U6 or GAPDH.
3
Genotyping of IFN-γ and IFN-γR1 SNPs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA for single-nucleotide polymorphism (SNP) genotyping was extracted from the peripheral blood of participants using salting out method according to Hashemi et al.23 (link) SNPs of IFN-γ +874T/A, IFN-γR1 −56 T/C, IFN-γR1 +95 C/T and IFN-γR1 −611A/G were genotyped with TaqMan Pre-Designed SNP Genotyping Assays (Applied Biosystems, Carlsbad, CA, USA). Polymerase chain reaction amplification and allelic discrimination were performed according to product specifications using the ABI 7500 Fast real-time polymerase chain reaction system (Applied Biosystems).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!