Three ESCC cell lines, EC109, EC9706 and KYSE180, and an immortal oesophageal epithelial cell line, Shantou Human Embryonic Oesophageal Epithelial (SHEE) cell line, were obtained from the Institute of Virology of the Chinese Academy of Preventive Medicine, Beijing, China. The cells were cultured in Gibco Dulbecco’s Modified Eagle Medium (DMEM; Thermo Fisher Scientific Inc., Waltham, MA, USA) with 10% foetal bovine serum (FBS; Thermo Fisher Scientific Inc.) and HyClone penicillin-streptomycin (100 U/mL and 100 μg/mL, respectively) (Cytiva, USA), and placed in a 5% CO2 cell culture incubator (Thermo Fisher Scientific Inc.) at a constant temperature of 37°C. The pcDNA3.1 plasmid that overexpressed the LINC00958 gene was constructed and named pcDNA3.1-LINC00958. The empty pcDNA3.1 vector was regarded as the control. For the knockdown of LINC00958, siRNA-LINC00958-1 CCUUUGUUUCCAAAGGUUACC , siRNA-LINC00958-2 GCCUUAAAACUCACAUAGAGA and siRNA-LINC00958-3 GCGAAACUCCAUCUAAAAAAA (KeyGEN BioTECH, Nanjing, China) were designed and synthesised. The jetPRIME transfection reagent (PolyPlus transfection, Illkirch, France) was used according to the manufacturer’s instructions for transfection. After 48 hours, the cells were collected.
Hyclone penicillin streptomycin
Manufactured by Cytiva
Sourced in United States
HyClone penicillin-streptomycin is a sterile, ready-to-use liquid that contains the antibiotics penicillin and streptomycin. It is commonly used in cell culture applications to prevent bacterial contamination.
Automatically generated - may contain errors
Lab products found in correlation
Jetprime transfection reagent, by Polyplus Transfection (1 mentions)
Foetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Gibco dulbecco s modified eagle medium dmem, by Thermo Fisher Scientific (1 mentions)
Co2 cell culture incubator, by Thermo Fisher Scientific (1 mentions)
Hfob1, by Thermo Fisher Scientific (1 mentions)
Hfob1, by American Type Culture Collection (1 mentions)
Sjsa 1, by American Type Culture Collection (1 mentions)
Pkh67 green fluorescent cell linker kit, by Merck Group (1 mentions)
3 protocols using hyclone penicillin streptomycin
1
LINC00958 Overexpression and Knockdown in Esophageal Cancer
2
Evaluating 4SC-202 Effects on Osteosarcoma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For this study all cell lines, including human osteosarcoma SJSA-1 (CRL-2098) and the human immortalized osteoblast hFOB 1.19 (ATCC, CRL-11372), were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA). SJSA-1 and hFOB 1.19 were grown in a humidified chamber containing 5% CO2 and cultured in a growth medium (HyClone™ MEM-α medium, Marlborough, MA, USA, SH30265FS) containing 10% fetal bovine serum (Fisher Scientific, Waltham, MA, USA, ES009B) and 1% HyClone™ penicillin-streptomycin (Cytiva, SV30010). However, the hFOB 1.19 cell line media also contained 0.3 mg/mL G418 (Fisher Scientific, 10-131-035) and was maintained at 34 °C, as per ATCC protocol. Cells in 100 mm tissue culture dishes (Fisher Scientific, 430167) were treated with 1 μM 4SC-202 (Adooq Bioscience, Irvine, CA, USA, A14354-25) for 24 h unless differently stated. The corresponding amount of DMSO (vehicle) was used as a control. All assays were performed at 37 °C.
3
Isolation and Labeling of MCF-7 Cell-Derived Extracellular Vesicles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Three T75 flasks of MCF-7 cells were cultured in serum-free medium supplemented with 10% fetal bovine serum (Cytiva HyClone™ Fetal Bovine Serum, South American Origin, Cytiva Inc., Marlborough, MA, USA) and 1% penicillin-streptomycin (HyClone Penicillin-Streptomycin, Cytiva Inc., Marlborough, MA, USA) and maintained at 37 °C in a humidified 5% CO2 incubator. After confluency, the cells were supplied with 10 mL of serum-free medium at 70% confluency and grown for another 48 hours for EVs secretion into the medium. The conditioned medium was harvested and centrifuged at 300 x g for 10 min, then 2,000 x g for 20 min to remove floating cells and debris. The supernatant was passed through a 0.22 μm syringe filter prior to UC at 210,000 x g for 70 min at 4°C to pellet the EVs. After supernatant was poured out, UC tube was inverted upside down and vacuumed using suction pump to remove supernatant remnant on UC tube. The EV pellet was stained with PKH67 Green Fluorescent Cell Linker Kit (Sigma-Aldrich, St. Louis, MO, USA). It was then washed at 210,000 x g for 70 min at 4°C to remove unbound PKH67 dye and the pellet was resuspended in 100 μL of PBS and kept at -20 °C for storage up to 2 months.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!