Log In Sign up
The largest database of trusted experimental protocols

Xl10 gold ultracompetent escherichia coli

Manufactured by Agilent Technologies
Visit Supplier
Sourced in United States

The XL10-Gold ultracompetent Escherichia coli is a strain of bacteria that is highly competent for DNA transformation. It is designed to efficiently uptake and maintain plasmid DNA during laboratory procedures.

Automatically generated - may contain errors

Lab products found in correlation

Miniprep kit, by Qiagen (2 mentions) T4 polynucleotide kinase, by New England Biolabs (2 mentions) Hifi dna polymerase, by Roche (1 mentions) In fusion hd cloning kit, by Takara Bio (1 mentions)

Close spelling variants of this product

XL10-gold ultracompetent Escherichia coli cells Escherichia coli XL10-Gold XL10-Gold

3 protocols using xl10 gold ultracompetent escherichia coli

1

CRISPR-Cas9 Knockout of var2csa Intron

Check if the same lab product or an alternative is used in the 5 most similar protocols
var intron knockout parasites were created from the 3D7 wild-type strain using the CRISPR/Cas9 system as previously described in reference 26 (link). For var2csa (Pf3D7_1200600), a 20-nucleotide sgRNA (GGTTTTTTGCAGAATGTCAC) was designed using Protospacer software (31 (link)) and inserted into the pL6 sgRNA expression plasmid. To facilitate knockout via homologous recombination, homology regions were ordered from GenScript, PCR amplified, and inserted into the same pL6 plasmid. Homology regions were designed by fusion of a 500-bp sequence of exon I directly upstream of the intron to a 500-bp sequence of exon II directly downstream of the intron. Silent shield mutations were introduced into and near the protospacer adjacent motif sequence of the homology region (GGTTTTTTGCAGAATGTCGCTCG [the mutations are underlined]). All cloning was performed using HiFi DNA polymerase (Kapa Biosystems), an In-Fusion HD cloning kit (Clontech), and XL10-Gold ultracompetent Escherichia coli (Agilent Technologies). Ring-stage parasites were transfected with pUF1-Cas9 and pL7 plasmids as previously described in reference 26 (link). Cloning of parasites was carried out by limiting dilution.
Bryant J.M., Regnault C., Scheidig-Benatar C., Baumgarten S., Guizetti J, & Scherf A. (2017). CRISPR/Cas9 Genome Editing Reveals That the Intron Is Not Essential for var2csa Gene Activation or Silencing in Plasmodium falciparum. mBio, 8(4), e00729-17.
+ Open protocol
+ Expand
2

Lentiviral CRISPR Knockdown Screening

Check if the same lab product or an alternative is used in the 5 most similar protocols
gRNAs targeting genes of interest were cloned into the sgRNA.EFS.tBFP vector using BsmBI digestion as previously described44 . Briefly, vectors were linearized with BsmBI (New England Biolabs) and gel purified (Qiagen spin miniprep). Annealed oligos were phosphorylated with T4 polynucleotide kinase (New England Biolabs), ligated into linearized vector backbone. Constructs were transformed into XL10-Gold ultracompetent Escherichia coli (Stratagene/Agilent Technologies, La Jolla, CA, USA), plasmids were purified using the MiniPrep Kit (Qiagen) and validated by Sanger sequencing. Lentivirus was produced as described above. HEK293TCas9 or SuDHL4Cas9 cells were transduced with sgRNAs. For BCL6 reporter assays, the effect of the knockdown was determined by quantifying the GFP/mCherry ratios in BFP/RFP657 positive and negative populations by flow cytometry seven days post infection. For competition assays, the percentage of BFP positive cells was monitored over time by flow cytometry (Supplementary Figure 2).
Słabicki M., Yoon H., Koeppel J., Nitsch L., Roy Burman S.S., Di Genua C., Donovan K.A., Sperling A.S., Hunkeler M., Tsai J.M., Sharma R., Guirguis A., Zou C., Chudasama P., Gasser J.A., Miller P.G., Scholl C., Fröhling S., Nowak R.P., Fischer E.S, & Ebert B.L. (2020). Small molecule-induced polymerization triggers degradation of BCL6. Nature, 588(7836), 164-168.
+ Open protocol
+ Expand
3

Lentiviral CRISPR Knockdown Screening

Check if the same lab product or an alternative is used in the 5 most similar protocols
gRNAs targeting genes of interest were cloned into the sgRNA.EFS.tBFP vector using BsmBI digestion as previously described44 . Briefly, vectors were linearized with BsmBI (New England Biolabs) and gel purified (Qiagen spin miniprep). Annealed oligos were phosphorylated with T4 polynucleotide kinase (New England Biolabs), ligated into linearized vector backbone. Constructs were transformed into XL10-Gold ultracompetent Escherichia coli (Stratagene/Agilent Technologies, La Jolla, CA, USA), plasmids were purified using the MiniPrep Kit (Qiagen) and validated by Sanger sequencing. Lentivirus was produced as described above. HEK293TCas9 or SuDHL4Cas9 cells were transduced with sgRNAs. For BCL6 reporter assays, the effect of the knockdown was determined by quantifying the GFP/mCherry ratios in BFP/RFP657 positive and negative populations by flow cytometry seven days post infection. For competition assays, the percentage of BFP positive cells was monitored over time by flow cytometry (Supplementary Figure 2).
Słabicki M., Yoon H., Koeppel J., Nitsch L., Roy Burman S.S., Di Genua C., Donovan K.A., Sperling A.S., Hunkeler M., Tsai J.M., Sharma R., Guirguis A., Zou C., Chudasama P., Gasser J.A., Miller P.G., Scholl C., Fröhling S., Nowak R.P., Fischer E.S, & Ebert B.L. (2020). Small molecule-induced polymerization triggers degradation of BCL6. Nature, 588(7836), 164-168.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!