RNA was extracted from murine tissues using the RNeasy Mini kit (Qiagen). RNA was converted to cDNA using Superscript III First Strand cDNA synthesis kit (Invitrogen). qPCR was then performed for each sorted cell subset in triplicate on ABI 7300 Real Time PCR system using primers to various genes specific to stromal cell subsets (mice or human) (Table 1 ). Gene expression was quantified relative to the endogenous housekeeping gene HPRT using 7000 System software from ABI. RNA from human tissues was extracted using the RNA-XS kit (Machery Nagel) followed by reverse-transcription with random hexamer primers. A Neviti Thermal Cycler (Applied Biosystems) and DyNAmo Flash SYBR Green qPCR kit (Finnzymes) were used for quantitative PCR, with the addition of MgCl2 to a final concentration of 4 mM. All reactions were done in duplicate and are normalized to the expression of GAPDH (glyceraldehyde phosphate dehydrogenase). Relative expression was calculated by the cycling threshold (CT) method as 2−Δt.
Rna xs kit
Manufactured by Macherey-Nagel
Sourced in Germany, France
The RNA XS kit is a laboratory product designed for the isolation and purification of small RNA molecules, such as microRNA, from various sample types. It provides a reliable and efficient method for obtaining high-quality RNA samples suitable for downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Agilent 2100 bioanalyzer, by Agilent Technologies (2 mentions)
Dynamo flash sybr green qpcr kit, by Thermo Fisher Scientific (1 mentions)
Neviti thermal cycler, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Superscript 3 first strand cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Revert aid first strand complementary dna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Nucleospin rna kit, by Macherey-Nagel (1 mentions)
Sybr green master mix, by Bio-Rad (1 mentions)
Cfx96 touch real time pcr detection system, by Bio-Rad (1 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
Quantitect reverse transcription kit, by Qiagen (1 mentions)
Nucleospin rna xs, by Macherey-Nagel (1 mentions)
First strand cdna synthesis kit for rt pcr, by Roche (1 mentions)
Hiseq 3000, by Illumina (1 mentions)
Iscript cdna synthesis kit, by Bio-Rad (1 mentions)
Quantstudio 6 real time pcr machine, by Thermo Fisher Scientific (1 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
Nanodrop nd 100 spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Fast sybr green mix, by Thermo Fisher Scientific (1 mentions)
10 protocols using rna xs kit
1
Quantification of Stromal Cell Gene Expression
2
Comprehensive RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using the Nucleospin RNA kit or RNA XS kit (both from Macherey-Nagel, Düren, Germany) according to the manufacturer’s instructions. Complementary DNA was synthesized from 0.25 to 1.0 μg RNA using the RevertAid First Strand Complementary DNA Synthesis Kit (Thermo Fisher). Real-time qPCR was performed with SYBR Green Master mix (Bio-Rad, Hercules, CA) using the CFX96 Touch Real-Time PCR Detection System (Bio-Rad). Expression values were normalized to β-actin expression. The sequences of all primers used can be found in Table 1 .
All Primer Sequences
| Gene | Forward primer, 5’---3’ | Reverse primer, 5’---3’ |
|---|---|---|
| CTSH | TACCTTCGAGGTACTGGTCCCT | GGTGGAGAAAGTCCAGCAACTG |
| WNT2 | AGGATGCCAGAGCCCTGATGAA | AGCCAGCATGTCCTGAGAGTAC |
| PI16 | CTGGTGTGCAACTATGAGCCTC | GGCAAATCCTGAGCATCTTCCG |
| SCUBE3 | CTCCAGGCAAAGAGGTCACAAG | TCCTTTCAGCCGCCGTTCCATT |
| SEMA3C | ACCCACTGACTCAATGCAGAGG | CAGCCACTTGATAGATGCCTGC |
| ACTA2 | CCGGGAGAAAATGACTCAAA | GAAGGAATAGCCACGCTCAG |
| VIM | TGTCCAAATCGATGTGGATGTTTC | TTGTACCATTCTTCTGCCTCCTG |
| FAP | ATCTATGACCTTAGCAATGGAGAATTTGT | GTTTTGATAGACATATGCTAATTTACTCCCAAC |
| CD31 | GCTGACCCTTCTGCTCTGTT | TGAGAGGTGGTGCTGACATC |
| CD45 | AACAGTGGAGAAAGGACACA | TGTGTCCAGAAAGGCAAAGC |
| KRT20 | CAGACACACGGTGAACTATGG | GATCAGCTTCCACTGTTAGACG |
| ACTB | GTTGTCGACGACGAGCG | GCACAGAGCCTCGCCTT |
3
Euthanasia and Tissue Collection for Gene Expression Analysis in Dry Eye Disease Mouse Models
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The healthy control, EDE-1, and EDE-2 mice were euthanized at the conclusion of the experiment on day 10 via an intraperitoneal injection of overdosed pentobarbital, as recommended for euthanasia by the European authorities (French decree no. 2013–118) [80 ].
Immediately after euthanasia, the cornea and conjunctiva of one eye were collected and snap frozen. Both eyes were collected from healthy controls to increase available material for the baseline state. Samples were stored at −80 °C for further total RNA extraction and subsequent gene expression analysis. Total RNA was extracted from corneas and conjunctivae according to the manufacturer’s protocol using an RNA-XS kit from Macherey-Nagel (Macherey-Nagel, Hoerdt, France). Total RNA yield and integrity were assessed with an Agilent 2100 bioanalyzer (Agilent Technologies, Wilmington, DE, USA). RNAs with an RNA integrity number (RIN) greater than seven were used for analysis. As the purpose of this workflow was based on the evaluation of samples from each mouse and according to the available quantity and integrity of the RNA, six groups of RNA samples were obtained: healthy control cornea (n = 32) and healthy control conjunctiva (n = 20), EDE-1 cornea (n = 18) and EDE-1 conjunctiva (n = 9), and EDE-2 cornea (n = 10) and EDE-2 conjunctiva (n = 10).
Immediately after euthanasia, the cornea and conjunctiva of one eye were collected and snap frozen. Both eyes were collected from healthy controls to increase available material for the baseline state. Samples were stored at −80 °C for further total RNA extraction and subsequent gene expression analysis. Total RNA was extracted from corneas and conjunctivae according to the manufacturer’s protocol using an RNA-XS kit from Macherey-Nagel (Macherey-Nagel, Hoerdt, France). Total RNA yield and integrity were assessed with an Agilent 2100 bioanalyzer (Agilent Technologies, Wilmington, DE, USA). RNAs with an RNA integrity number (RIN) greater than seven were used for analysis. As the purpose of this workflow was based on the evaluation of samples from each mouse and according to the available quantity and integrity of the RNA, six groups of RNA samples were obtained: healthy control cornea (n = 32) and healthy control conjunctiva (n = 20), EDE-1 cornea (n = 18) and EDE-1 conjunctiva (n = 9), and EDE-2 cornea (n = 10) and EDE-2 conjunctiva (n = 10).
4
RNA Isolation and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After 18 hr of treatment hiMGCs and pMGCs were lysed and RNA purified using the RNA XS kit (Macherey‐Nagel, Cat. #740902) according to the manufacturer's protocol. Total RNA was isolated and converted to cDNA using QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany Cat. #205314). Each reverse transcription assay was performed in a 20 μl reaction. Subsequent real‐time qPCR was performed using cDNA, Sybr Green PCR Master Mix (ThermoFisher Scientific, Cat. #4367659) in StepOne Plus real‐time PCR system (ThermoFisher Scientific, Applied Biosystems™) with the following profile: 10 min at 95°C, followed by a total of 40 two‐temperature cycles (15 s at 95°C and 1 min at 60°C). To verify the purity of the products, a melting curve was produced after each run according to the manufacturer's instructions. Results were expressed as fold induction after normalization by RPS26 gene expression. Primers for RT‐qPCR were purchased from IDT technology (Table S5 ).
5
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Flies carrying the transgenic TF of interest were crossed to yw;C765-Gal4 tubGal80ts salm-eGFP/TM6b. Flies were kept at 21°C until 24 h before dissection, when they were shifted to 29°C to induce transgene expression. RNA was isolated from 2 × 30–40 wing discs and purified using the RNA XS kit (NucleoSpin RNA XS, 740902.10, Machery-Nagel). Five hundred nanograms of RNA was reverse transcribed into cDNA according to the manufacturer's guidelines (first strand cDNA synthesis kit for RT-PCR, 11483188001, Roche) using Oligo-p(dT)15 primer. cDNA was directly used as template for qRT-PCR using the ABI SYBR green system. Transcript levels were normalized to act, tub, and Tbp.
The following gene-specific primer sequences were used:
The following gene-specific primer sequences were used:
Tub for: GCCAGATGCCGTCTGACAA
Tub rev: AGTCTCGCTGAAGAAGGTGTTGA
Act for: GCCCATCTACGAGGGTTATGC
Act rev: AATCGCGACCAGCCAGATC
TBP for: CGCGCATCATCCAAAAGC
TBP rev: GCCGACCATGTTTTGAATCTTAA
Hid for: TCTACGAGTGGGTCAGGATGT
Hid rev: GCGGATACTGGAAGATTTGC
Rpr for: TCGATTTCTACTGCAGTCAAGG
Rpr rev: GAGTAAACTAAAATTGGGTGGGTGT
Omb for: GCGAAGGGCTTTCGTGATAC
Omb rev: GACCCTCGGTTCGACATCAG
6
RNA-seq Analysis of Sorted Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from ~300,000 sorted cells using manufacturer’s instructions using the RNA XS Kit (Macherey Nagel). cDNA synthesis and amplification were performed with a Pico Input RNA Kit, according to the manufacturer’s instructions (Clontech). Libraries were sequenced on a HiSeq3000 (Illumina) in single-read mode, with a read length of 50 nucleotides producing ~25 million reads per sample. Sequence tags were mapped onto the NCBI37 mm9 with TopHat [43 ], followed by transcript assembly and Reads Per Kilo base of exon per Million reads (RPKM) estimation using Cufflinks [44 (link)–46 ] on the Galaxy platform (https://usegalaxy.org/ ). The raw data has been deposited at NCBI GEO with an accession number GSE112778.
7
Quantifying NeuroD1 Transcript Dynamics
8
Conjunctival RNA Extraction and Evaluation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted from conjunctival cells using an RNA-XS kit from Macherey-Nagel. RNA yield and purity were assessed using NanoDrop ND-100 Spectrophotometer (NanoDrop technologies, Rockland, DE, USA). The RNA purity was assessed using the absorbance ratio between RNA and proteins, read at 260 and 280 nm, respectively (A260/280). Total RNA integrity was evaluated with the Agilent 2100 bioanalyzer (Agilent Technologies, Wilmington, DE, USA) according to the manufacturer's specifications.
An RNA integrity number (RIN) greater than 8 was considered as an acceptable quality criterion for the analysis. The instrument software generates a RIN score based on its entire electropherogram. RIN values range from 1 to 10, from a totally degraded RNA to the highest-quality RNA. A cut-off of RIN = 8.0 was used to ensure good RNA quality. RNA from CIs shows a high quality with a RIN greater than 8 for all samples. Total RNA, with a high RNA quality and purity (A260/280 = 1.8; RIN > 8), isolated from conjunctival cells collected from the 88 DED patients was used for quantitative analysis using the inflammatory NanoString® CodeSet panel.
An RNA integrity number (RIN) greater than 8 was considered as an acceptable quality criterion for the analysis. The instrument software generates a RIN score based on its entire electropherogram. RIN values range from 1 to 10, from a totally degraded RNA to the highest-quality RNA. A cut-off of RIN = 8.0 was used to ensure good RNA quality. RNA from CIs shows a high quality with a RIN greater than 8 for all samples. Total RNA, with a high RNA quality and purity (A260/280 = 1.8; RIN > 8), isolated from conjunctival cells collected from the 88 DED patients was used for quantitative analysis using the inflammatory NanoString® CodeSet panel.
9
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nuclear, cytoplasmic or total RNA was prepared from GH4C1 cells using an RNA XS kit (Macherey Nagel, Hoerdt, France). Total RNA purification was performed on 24-well cell dishes. Nuclear and cytoplasmic RNA isolation was performed using 10 cm cell dishes that were rinsed twice with ice-cold PBS, incubated in 1 ml of ice-cold cell lysis buffer A (10 mmol/L Tris pH 7.4, 3 mmol/L MgCl2, 10 mmol/L NaCl and 0.5% NP-40). Nuclei and cytoplasma were separated by centrifugation (500 x g for 5 min). One-sixth of the supernatant was used to prepare cytoplasmic RNA. To obtain pure nuclear RNA, the nuclear pellets were subjected to two additional washes with 1 ml lysis buffer A and were then extracted with XS kit reagent. Total RNA (500 ng) was then used for cDNA synthesis performed with a High Capacity RNA to cDNA kit (Applied Biosystem, Courtaboeuf, France). Real-time PCR was performed on a 7500 fast Real-Time qPCR system (Applied Biosystems) using Fast SYBR Green mix (Applied Biosystems). The sequences of the primers used in qPCR are given in Figure 2—source data 1 . mRNA accumulation was normalized relative to Gapdh mRNA levels.
10
Transcriptome Analysis of Melanocyte Rack1 Knockdown
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extractions were performed on 20,000 FACS-sorted cells following RNA XS kit manufacturer instructions (Macherey Nagel, Germany) as described [13] . RNA sequencing (RNA-seq) on shScramble and shRack1-treated melanocytes, primary melanoma from Tyr::NRas ⁎ ; Pax3 GFP/+ cells with or without Tyr::Rack1-HA was performed on technical triplicates of viral infection. Libraries were prepared by selecting polyadenylated mRNA using the TruSeq RNA Sample Prep Kit (Illumina, San Diego, CA). When performed on plated infected cells, RNA was prepared from 10 6 cells in 6 well plates. qPCR assays on cDNA from primary cells infected with shRack1 were performed using TATAA Granscript cDNA Supermix for reverse transcription and TATAA SYBR GranMaster mix on a Light Cycler480 qPCR instrument (Roche) (TATAA Biocenter, Czech Republic). Actb, Gapdh, Tubb5 and Rnp2 were used as reference genes. Experiments were carried out at least twice in triplicates.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!