RNA was extracted from whole brain regions (PFC and somatosensory cortex; SSCTX) using TRIzol Reagent according to manufacturer’s protocol (Invitrogen). RNA was extracted from astrocytes using a Single Cell RNA purification kit in combination with DNAse treatment (Norgen Biotek Corp., #51800). Samples were reverse transcribed using a High-Capacity cDNA Reverse Transcription Kit (ThermoFisher Scientific, #4368814). Quantitative real-time PCR was conducted using a QuantStudio 5 Real-Time PCR System (ThermoFisher Scientific). All samples were run in triplicate. Cycle threshold (CT) was determined for all genes and normalized to the geometric mean of Gapdh and Tbp. Fold change was standardized to control males using the 2−∆∆CT method. Primer sequences are listed in Table S1 .
Dnase treatment
Manufactured by Norgen Biotek
The DNAse treatment is a product designed to remove DNA contaminants from RNA samples. It functions by utilizing DNAse enzymes to break down and eliminate DNA molecules present in the sample, ensuring the purity and integrity of the extracted RNA for downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Superscript 3 reverse transcriptase kit, by Thermo Fisher Scientific (2 mentions)
Quantstudio6 thermal cycler, by Thermo Fisher Scientific (2 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Faststart sybr green master mix, by Roche (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Quantstudio 5 real time pcr system, by Thermo Fisher Scientific (1 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Single cell rna purification kit, by Norgen Biotek (1 mentions)
Platinum taq high fidelity polymerase, by Thermo Fisher Scientific (1 mentions)
Ssiii, by Thermo Fisher Scientific (1 mentions)
Random hexamers for priming, by Thermo Fisher Scientific (1 mentions)
Oligo dt, by Thermo Fisher Scientific (1 mentions)
Fast sybr green master mix, by Thermo Fisher Scientific (1 mentions)
7900ht fast real time instrument, by Thermo Fisher Scientific (1 mentions)
6 protocols using dnase treatment
1
Brain Region RNA Extraction and qPCR
2
RNA Isolation and cDNA Synthesis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using a total RNA isolation kit, including an on-column DNase treatment (Norgen). cDNA synthesis was carried out using the SuperScript III reverse transcriptase kit using oligodT for priming (Life Technologies). PCR amplification was carried out using high-fidelity platinum Taq polymerase according to the manufacturer's protocol (Life Technologies). The reactions were separated on 1.5% or 2% agarose gels, depending on the expected amplicon sizes, and stained with ethidium bromide. Band intensity was quantified using ImageJ (National Institutes of Health). The sequences of the primers used for all semiquantitative RT–PCR experiments are in Supplemental Table S2.
3
Comparative mRNA Stability Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from MDA-parental and MDA-LM2 cells using a total RNA isolation kit with on-column DNase treatment (Norgen). Upon first-strand cDNA synthesis (SSIII, Life Technologies), relative levels of each mRNA of interest were assessed by qRT-PCR (ABI 7300 Real-Time System), using 18S as the endogenous control. Primer sequences are listed in Supplementary Table 1 . For each cell-line, relative stability for each gene was defined as the 9-hr/0-hr ratio. Statistical significance was determined using Mann–Whitney U-test on relative stabilities.
4
Quantitative Real-Time PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using a total RNA isolation kit, including an on-column DNase treatment (Norgen). cDNA synthesis was carried out using the SuperScript III reverse transcriptase kit using a mixture of oligodT and random hexamers for priming (Life Technologies). qRT–PCR was carried out using Fast SYBR Green master mix (Applied Biosystems), and fluorescence was monitored using a 7900HT Fast real-time instrument (Applied Biosystems). Data were analyzed using the ΔΔCt method. The endogenous control transcripts that were used for normalization are indicated in each figure. Statistical significance was determined using a one-tailed Student's t-test. The sequences of the primers used for all qRT–PCR assays are in Supplemental Table S2.
5
Quantitative Gene Expression Analysis by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using commercial kits with DNAse treatment (Norgen). cDNA synthesis was carried out with M-MLV Reverse Transcriptase (Thermo) and oligo-dT primers. qPCR reactions were assembled with FastStart SYBR Green Master Mix (Roche) and run on a QuantStudio6 thermal cycler (Thermo). Gene expression levels for each biological sample were quantified as the mean between three technical replicates; GAPDH expression levels were used to normalize gene expression between samples. See Table 3 for primer sequences.
Primer sequences.
| qPCR Primer | For | Rev |
|---|---|---|
| hGAPDH | CTCCTGCACCACCAACTGCT | GGGCCATCCACAGTCTTCTG |
| hFSCN1 | CAAGAAGAATGGGCAGCTGG | CTTTGATGTTGTAGGCGCCA |
| hFSCN2_1 | ACGAGACCTTCCTGATGCAA | CCAGCTGCCCATTCTTCTTC |
| hFSCN2_2 | GAAGAAGAATGGGCAGCTGG | CAGGTGGAAGACGTCGTAGA |
| hFSCN3_1 | TCCAGGCCCAAATGAGGAAT | CTGTGCCTGGAAGTGGTAGA |
| hFSCN3_2 | GCGCTTAAACCGAATGTCCT | ATGATCCTGCCACAGTTCCA |
| mGAPDH | ATCCTGCACCACCAACTGCT | GGGCCATCCACAGTCTTCTG |
| mANKRD1 | CTGTGAGGCTGAACCGCTAT | TCTCCTTGAGGCTGTCGAAT |
| mCTGF | CTGCCTACCGACTGGAAGAC | CATTGGTAACTCGGGTGGAG |
| mFSCN1 | CAAGTTTGTGACCGCCAAGA | GTAGGCGCCGTCATTGAATT |
6
Quantitative PCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using commercial kits with DNAse treatment (Norgen). cDNA synthesis was carried out with M-MLV Reverse Transcriptase (Thermo) and oligo-dT primers. qPCR reactions were assembled with FastStart SYBR Green Master Mix (Roche)
and run on a QuantStudio6 thermal cycler (Thermo). Gene expression levels for each biological sample were quantified as the mean between three technical replicates; GAPDH expression levels were used to normalize gene expression between samples. Primer sequences are provided in the following Table .
qPCR Primer For Rev
and run on a QuantStudio6 thermal cycler (Thermo). Gene expression levels for each biological sample were quantified as the mean between three technical replicates; GAPDH expression levels were used to normalize gene expression between samples. Primer sequences are provided in the following Table .
qPCR Primer For Rev
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!