C2C12 cells were proliferated in medium containing 15% FCS, 2 mM non-essential amino acids, 1 mM sodium pyruvate, 100 U/ml penicillin and 100 μg/ml streptomycin, and differentiated in medium containing 2% HS, 2 mM non-essential amino acids, 1 mM sodium pyruvate, 100 U/ml penicillin and 100 μg/ml streptomycin, both in Dulbecco’s modified Eagle medium (DMEM), high glucose, with GlutaMax (all components from Thermo Fischer Scientific Gibco, Darmstadt, Germany). Media were changed every two days. For EPS lesion induction and quantification, cells were seeded on ethanol-washed and autoclaved 15 mm coverslips placed in 6-well plates (CytoOne/Starlab, Hamburg, Germany). For live experiments, cells were seeded in 2 cm Lab-Tek chamber slides (Thermo Fischer Scientific Nunc, Rochester, USA) and transfected with a construct encoding human FLNc fused to EGFP57 (link) using JetPrime (Polyplus-transfection SA, Illkirch, France) for 4–6 hours according to the instructions of the manufacturer, using 2 μg DNA and 4 μl JetPrime in 200 μl JetPrime buffer per well of a 6-well plate, or per 2 wells of a Lab-Tek chamber slide.
Jetprime
Manufactured by Polyplus Transfection
Sourced in France, United States, China, United Kingdom, Germany
JetPRIME is a transfection reagent that facilitates the delivery of nucleic acids, such as plasmid DNA, siRNA, and mRNA, into a variety of mammalian cell lines. It is designed to enhance transfection efficiency while maintaining high cell viability.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000, by Thermo Fisher Scientific (75 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (49 mentions)
Lipofectamine rnaimax, by Thermo Fisher Scientific (36 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (34 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (34 mentions)
Polybrene, by Merck Group (24 mentions)
Dual luciferase reporter assay system, by Promega (23 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (22 mentions)
Penicillin, by Thermo Fisher Scientific (19 mentions)
Streptomycin, by Thermo Fisher Scientific (18 mentions)
Interferin, by Polyplus Transfection (17 mentions)
Pspax2, by Addgene (14 mentions)
Pmd2 g, by Addgene (12 mentions)
Jetpei, by Polyplus Transfection (12 mentions)
Peg it, by System Biosciences (12 mentions)
Rnaimax, by Thermo Fisher Scientific (12 mentions)
Puromycin, by InvivoGen (10 mentions)
Puromycin, by Merck Group (10 mentions)
Fetal bovine serum (fbs), by Merck Group (10 mentions)
Glutamax, by Thermo Fisher Scientific (10 mentions)
1 003 protocols using jetprime
1
C2C12 Cell Differentiation and Transfection
2
GABA-A Receptor Subunit Transfection and TCO Labeling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
At 60–80% confluency HEK-293-T cells were transfected using Jetprime (Jetprime, Polyplus) applying a 2:1 DNA/Jetprime ratio. GABA-A receptor subunits were transfected at the following ratio with a total amount of 1750 ng DNA per well: 500 ng α2 subunit, 500 ng β1 subunit, 250 ng γ2 subunit, and 500 ng pCMV NES-PylRSAF/tRNAPyl.
TCO∗ (SiChem, SC-8008, Bremen, Germany) was fed separately (250 μM final), diluted in 1M HEPES (one part of 100 mM TCO-A was added to three parts of 1M HEPES, and added in the corner of a single well of four-well Labtek chamber). After 24 h, the medium was exchanged to fresh cell growth medium. The cells were incubated approx. 48 h before labeling and fixation.
Hippocampal neurons were transfected at DIV 14 with the clickable α2 subunit and pCMV NES-PylRSAF/tRNAPyl in 1:2 ratio along with EGFP using Effectene (#301425, Qiagen, Germany) following the manufacturer’s protocol. The following day (DIV 15) each coverslip was supplemented with TCO 250 μM.
TCO∗ (SiChem, SC-8008, Bremen, Germany) was fed separately (250 μM final), diluted in 1M HEPES (one part of 100 mM TCO-A was added to three parts of 1M HEPES, and added in the corner of a single well of four-well Labtek chamber). After 24 h, the medium was exchanged to fresh cell growth medium. The cells were incubated approx. 48 h before labeling and fixation.
Hippocampal neurons were transfected at DIV 14 with the clickable α2 subunit and pCMV NES-PylRSAF/tRNAPyl in 1:2 ratio along with EGFP using Effectene (#301425, Qiagen, Germany) following the manufacturer’s protocol. The following day (DIV 15) each coverslip was supplemented with TCO 250 μM.
3
Plasmid Transfection and RNF157 Knockdown
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmid transfection was performed using jetPRIME (Polyplus) with a 1:3 DNA to jetPRIME ratio (w/v) according to the manufacturer's instructions. In the knockdown assay, HLE-B3 cells were transfected with 12.5 nmol/L siRNA and Lipofectamine RNAiMAX (Invitrogen). The sequences for siRNAs were as follows: human RNF157 siRNAs (#1: CCATCACCATCTATTACCA; #2: CCGAGAAGTTTACCCTCTA; and #3: CTGGCAGGCTGATGACAAT); human p53 siRNA (#1: CAGUCUACCUCCCGCCAUA; and #2: GAGGUUGGCUCUGACUGUA); and negative control (NC) siRNA (UUCUCCGAACGUGUCACGU). After verifying the knockdown efficiency, siRNF157 #1 and siRNF157 #2 were mixed and transfected into cells.
4
Pyroptosis Induction and STING Activation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ana-1 cells were plated in six-well plates until 50–60% confluence was achieved. They were transfected with siRNAs using jetPRIME® (Polyplus, 101000046) according to the manufacturer’s protocol; si-NC (RiboBio, China) was used as a negative control in vitro. Pyroptosis was induced via sequential administration of LPS and nigericin 48 h after transfection. C57BL/6 mice were administered tail vein injection of 10 nmol/20 g siRNA to knockdown the expression levels of IRF3 and IRF7 on day 3 and day 1; si-NC (RiboBio, China) was used as a negative control in vivo. The mouse model of SAP was induced via an intraperitoneal injection of LPS combined with CAE on day 0. The sequences of siRNA are listed in Additional file 1 : Table S1.
We plated Ana-1 cells in six-well plates until 90% confluence was achieved. They were transfected with 10 µg/mL 2′,3′-cGAMP (MCE, HY-100564) or 5 µg/mL poly(dA:dT) (Invivogen, tlrl-patn) for 6 h using jetPRIME® (Polyplus, 101000046) to activate the STING signal.
We plated Ana-1 cells in six-well plates until 90% confluence was achieved. They were transfected with 10 µg/mL 2′,3′-cGAMP (MCE, HY-100564) or 5 µg/mL poly(dA:dT) (Invivogen, tlrl-patn) for 6 h using jetPRIME® (Polyplus, 101000046) to activate the STING signal.
5
Evaluating ST8SIA1 Expression and Colony Formation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
M16, ML‐0817, and M‐204 cells (0.3 × 106 cells/well) were seeded in 6‐well culture plates (Corning, NY, USA) and transfected with T7‐tagged pReceiver‐M98 vector encoding ST8SIA1 (GeneCopoeia, Rockville, MD, USA) using jetPRIME (Polyplus Transfection, New York, NY, USA). ST8SIA1 overexpression was evaluated using quantitative reverse transcriptase/polymerase chain reaction (qRT‐PCR). DP‐0574 and M‐204 cells (0.3 × 106/well in 6‐well culture plates) were transfected with 10 nm ON‐TARGETplus Human ST8SIA1 siRNA SMARTpool (#L‐011775‐01‐0005; Dharmacon, Thermo Fisher Scientific, Carlsbad, CA, USA) and ON‐TARGETplus nontargeting pool (#D‐001810‐10‐05; Dharmacon) using jetPRIME (Polyplus Transfection). ST8SIA1 expression was evaluated 48 h after transfection by qRT‐PCR. For colony formation assay, transfected cells were seeded (2000 cells/well in a 6‐well culture plate) and incubated for 12 days. Colonies were stained with crystal violet and quantified as previously described (Bustos et al., 2017 ).
6
Stable XRCC1 Depletion in MDA-468 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmid constructs for stable depletion of human XRCC1 mRNA were obtained from Sigma-Aldrich (MISSION shRNA). Two different shRNAs against XRCC1 were used: XRCC1 shRNA 1 - (TRCN000011211): CCGGCGATACGTCACAGCCTTCAATCTCGAGATTGAAGGCTGTGACGTATCGTTTTT XRCC1 shRNA 2 - (TRCN0000007913): CCGGCCAGTGCTCCAGGAAGATATACTCGAGTATATCTTCCTGGAGCACTGGTTTTT . pKLO.1 plasmid without insert was also purchased from Sigma-Aldrich and transfected in parallel with shRNAs. MDA-468 cells were plated at 40,000 cells per well into a 12-well dish. The next day cells were transfected with 0.5 μg plasmid DNA and JetPrime (Polyplus) at a 1:2 ratio of DNA to JetPrime. Cells were allowed to recover for 48 h following transfection; then stable cell lines were recovered after puromycin selection (0.5 μg/ml, Life Technologies). Single-cell clones were isolated and after immunoblot analysis, those demonstrating significant XRCC1 knockdown were characterized. No difference in XRCC1 expression or cell sensitivity was observed with the MDA-468 pLKO.1 control cell line compared to the MDA-468 parental.
7
Cell Culture and Transfection Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293T and HeLa cells were purchased from ATCC and grown in DMEM (Dulbecco’s modified Eagle’s medium; Corning, cat#10-013-CVR) supplemented with 10% FBS (fetal bovine serum; Corning, cat#35-076-CV) at 37 °C with an atmosphere of 5% CO2 in a humidified incubator. For transfection, HEK293T cells were grown in cell culture dishes or plates to about 70% confluence and transfected with indicated plasmids using PEI (Polysciences) in Opti-MEM media (ThermoFisher) at a 2.5:1 ratio of PEI/DNA for about 18 to 24 h. HeLa cells were transfected with a 2.5:1 ratio of transfection reagent/DNA using Viafect (Promega) or jetPRIME (Polyplus) according to the manufacturer’s protocol in Opti-MEM media or jetPRIME buffer at 70% confluence.
8
Cell Seeding and Transfection Optimization
9
Cell Seeding and Transfection Optimization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For adherent HeLa and HEK293T cells, 4 × 105 cells were seeded directly into 12-well plates (VWR) for western blotting, and 1.5 × 105 cells were seeded onto sterile coverslips (18 mm ø No. 1 German cover glasses, VWR VistaVision™, VWR International) deposited into 12-well plates for imaging. 0.8 × 105 cells were seeded per chamber of 4-chamber wells (Lab-Tek®II Chambered #1.5 German Coverglass System; ThermoFisher) for live cell imaging microscopy. Cells were transfected 24 hr later with 2 µg plasmid DNA per well using JetPrime (PolyPlus) according to the manufacturer’s instructions. pcDNA3.1 was used as control for transfections with pNL4–3, and pRluc-N1 was used as control for experiments using p2-p1/Rluc (i.e., NC-RLuc). Jurkat T cells were transfected with 3 µg of plasmid DNA per 1 × 106 cells using JetPrime (PolyPlus) for 12 days prior to treatments or collection.
10
Stable knockdown of ABCB6 and ABCB9 in cell lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The HEK-293T cell line, which is a derivative of human embryonic kidney 293 cells, transformed with the SV40 T-antigen, and the Mel JuSo and UACC-257 melanoma cell lines were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (GE Healthcare Life Sciences) and 1% penicillin/streptomycin (Gibco) at 37 °C and 5% CO2 in a humidified atmosphere.
For transient transfections, cells were seeded to reach 70% confluence in a 6-well plate. Four hours later, transfection with jetPRIME (Polyplus transfection) was carried out following the manufacturer’s instructions.
shRNAs constructs for the stable knockdown of human ABCB6 (sc-94721-SH) and ABCB9 (sc-60115-SH) were obtained from Santa Cruz Biotechnology. A nonsilencing shRNA was used as a control (sc-108060). Reverse transfection was performed in antibiotic-free medium with jetPRIME, following the manufacturer’s instructions (Polyplus transfection). Seventy-two hours after transfection, the selection of the transfected cells was carried out by the addition of 2 μg/ml of puromycin. After 10 days of selection, ABCB6 and ABCB9 mRNA and protein expression were assessed using reverse transcription-quantitative polymerase chain reaction and Western blot.
For transient transfections, cells were seeded to reach 70% confluence in a 6-well plate. Four hours later, transfection with jetPRIME (Polyplus transfection) was carried out following the manufacturer’s instructions.
shRNAs constructs for the stable knockdown of human ABCB6 (sc-94721-SH) and ABCB9 (sc-60115-SH) were obtained from Santa Cruz Biotechnology. A nonsilencing shRNA was used as a control (sc-108060). Reverse transfection was performed in antibiotic-free medium with jetPRIME, following the manufacturer’s instructions (Polyplus transfection). Seventy-two hours after transfection, the selection of the transfected cells was carried out by the addition of 2 μg/ml of puromycin. After 10 days of selection, ABCB6 and ABCB9 mRNA and protein expression were assessed using reverse transcription-quantitative polymerase chain reaction and Western blot.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!